#NEXUS begin taxa; dimensions ntax=55; taxlabels '2015.303.rbcL_MSF_#11_c2e2_consensus'[&MQ%=12.2%,Ambiguities=0,"% Pairwise Identity"=100.0%,LQ%=4.6%,%GC=37.7%,Modified=Fri Aug 26 13:53:02 EDT 2016,"Mean Coverage"=1.196969696969697,Bin="<2>Medium",description="Alignment of 2 sequences: 2015.303.rbcL.M35F_005.ab1, 2015.303.rbcL.M1161R_007.ab1 (reversed)","# Nucleotide Sequences With Quality"=1,"% Identical Sites"=100.0%,Post-Trim=990,Topology="linear","Alignment method"="Geneious Alignment",Created=Fri Aug 26 13:53:26 EDT 2016,URN="urn:local:.:1j-6j895i5","Failed Binning Fields"="HQ%","# Source Sequences"=2,"Free end gaps"=true,HQ%=83.1%,"Molecule Type"="DNA"] '2015.298.rbcL_MSF_#11_c2e1_consensus'[&"% Pairwise Identity"=100.0%,%GC=37.7%,"Genetic Code"="Bacterial",Modified=Tue May 31 21:15:24 EDT 2016,"Mean Coverage"=1.906060606060606,description="Alignment of 2 sequences: 2015.298.rbcL.M35F, 2015.298.rbcL.M1161R (reversed)","# Nucleotide Sequences With Quality"=0,"% Identical Sites"=100.0%,Topology="linear","Alignment method"="Geneious Alignment",Created=Tue May 31 21:15:45 EDT 2016,URN="urn:local:.:1a-677vbfr","# Source Sequences"=2,"Free end gaps"=true,"Molecule Type"="DNA"] '2015.299.rbcL_MSF_#11_c2e1_consensus'[&"% Pairwise Identity"=100.0%,%GC=37.7%,"Genetic Code"="Bacterial",Modified=Wed Jun 01 07:39:30 EDT 2016,"Mean Coverage"=1.784848484848485,description="Alignment of 2 sequences: 2015.299.rbcL.M35F, 2015.299.rbcL.M1161R (reversed)","# Nucleotide Sequences With Quality"=0,"% Identical Sites"=100.0%,Topology="linear","Alignment method"="Geneious Alignment",Created=Wed Jun 01 07:39:37 EDT 2016,URN="urn:local:.:19-677vbfr","# Source Sequences"=2,"Free end gaps"=true,"Molecule Type"="DNA"] '2015.301.rbcL_MSF_#11_c2e2_consensus'[&"% Pairwise Identity"=100.0%,%GC=37.7%,"Genetic Code"="Bacterial",Modified=Tue May 31 21:18:21 EDT 2016,"Mean Coverage"=1.91010101010101,description="Alignment of 2 sequences: 2015.301.rbcL.M35F, 2015.301.rbcL.M1161R (reversed)","# Nucleotide Sequences With Quality"=0,"% Identical Sites"=100.0%,Topology="linear","Alignment method"="Geneious Alignment",Created=Tue May 31 21:18:32 EDT 2016,URN="urn:local:.:18-677vbfr","# Source Sequences"=2,"Free end gaps"=true,"Molecule Type"="DNA"] '2015.302.rbcL_MSF_#11_c2e2_consensus'[&"% Pairwise Identity"=100.0%,%GC=37.8%,"Genetic Code"="Bacterial",Modified=Tue May 31 13:40:47 EDT 2016,"Mean Coverage"=1.959033613445378,description="Alignment of 2 sequences: 2015.302.rbcL.M35F, 2015.302.rbcL.M1161R (reversed)","# Nucleotide Sequences With Quality"=0,"% Identical Sites"=100.0%,Topology="linear","Alignment method"="Geneious Alignment",Created=Tue May 31 13:40:54 EDT 2016,URN="urn:local:.:17-677vbfq","# Source Sequences"=2,"Free end gaps"=true,"Molecule Type"="DNA"] '2015.304.rbcL_MSF_#11_c3e1_consensus'[&"% Pairwise Identity"=100.0%,%GC=37.7%,Modified=Tue May 10 13:39:35 EDT 2016,"Mean Coverage"=3.201010101010101,description="Alignment of 4 sequences: 2015.304.rbcL.M35F, 2015.304.rbcL.M35F.4.14.16, 2015.304.rbcL.M1161R (reversed), 2015.304.rbcL.M1161R.4.14.16 (reversed)","# Nucleotide Sequences With Quality"=0,"% Identical Sites"=100.0%,Topology="linear","Alignment method"="Geneious Alignment",Created=Tue May 31 13:41:35 EDT 2016,URN="urn:local:.:16-677vbfq","# Source Sequences"=4,"Free end gaps"=true,"Molecule Type"="DNA"] '2015.305.rbcL_MSF_#11_c3e1_consensus'[&"% Pairwise Identity"=100.0%,%GC=37.9%,"Genetic Code"="Bacterial",Modified=Tue May 31 13:42:01 EDT 2016,"Mean Coverage"=1.9684542586750788,description="Alignment of 2 sequences: 2015.305.rbcL.M35F, 2015.305.rbcL.M1161R (reversed)","# Nucleotide Sequences With Quality"=0,"% Identical Sites"=100.0%,Topology="linear","Alignment method"="Geneious Alignment",Created=Tue May 31 13:42:08 EDT 2016,URN="urn:local:.:15-677vbfp","# Source Sequences"=2,"Free end gaps"=true,"Molecule Type"="DNA"] '2015.306.rbcL_MSF_#11_c3e2_consensus'[&"% Pairwise Identity"=100.0%,%GC=37.9%,"Genetic Code"="Bacterial",Modified=Tue May 31 13:42:32 EDT 2016,"Mean Coverage"=1.9631190727081138,description="Alignment of 2 sequences: 2015.306.rbcL.M35F, 2015.306.rbcL.M1161R (reversed)","# Nucleotide Sequences With Quality"=0,"% Identical Sites"=100.0%,Topology="linear","Alignment method"="Geneious Alignment",Created=Tue May 31 13:42:40 EDT 2016,URN="urn:local:.:14-677vbfp","# Source Sequences"=2,"Free end gaps"=true,"Molecule Type"="DNA"] '2015.307.rbcL_MSF_#11_c3e3_consensus'[&"% Pairwise Identity"=100.0%,%GC=37.7%,"Genetic Code"="Bacterial",Modified=Tue May 31 13:43:09 EDT 2016,"Mean Coverage"=1.8131313131313131,description="Alignment of 2 sequences: 2015.307.rbcL.M35F, 2015.307.rbcL.M1161R (reversed)","# Nucleotide Sequences With Quality"=0,"% Identical Sites"=100.0%,Topology="linear","Alignment method"="Geneious Alignment",Created=Tue May 31 13:43:16 EDT 2016,URN="urn:local:.:13-677vbfp","# Source Sequences"=2,"Free end gaps"=true,"Molecule Type"="DNA"] Carteria_radiosa__D89770_ Carteria_cerasiformis Carteria_sp_SAG_8_5 Characiochloris_acuminata_NIES_637_AB360752 'Chlainomonas_rubra__DQ885969.2_' 'Chlamydomonas_acidophila__KT_1__AB127986.1_' 'Chlamydomonas_gloeophila_strain_UTEX_608_gb|KJ635656.1|'[&URN="urn:local:.:mq-678bf6e",%GC=41.2%,Modified=Mon Jun 06 18:33:55 EDT 2016,"Path (Imported From)"="/Users/volvox/Downloads",description="Chlamydomonas gloeophila strain UTEX_608 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="sequence (3).fasta","Molecule Type"="DNA",Created=Fri Jun 03 14:38:36 EDT 2016] 'Chlamydomonas_moewusii_UTEX_97_gb|EF587479.1|'[&URN="urn:local:.:jc-677xlgi",%GC=41.3%,Modified=Mon Jun 06 18:29:43 EDT 2016,"Path (Imported From)"="/Users/Nik/Downloads",description="Chlamydomonas moewusii strain UTEX 97 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, complete cds; chloroplast","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="seqdump (2).txt","Molecule Type"="DNA",Created=Fri Jun 03 10:09:23 EDT 2016] 'Chlamydomonas_pseudogloeogama_gb|EF589142.1|'[&URN="urn:local:.:jb-677xlgi",%GC=38.3%,Modified=Mon Jun 06 18:29:26 EDT 2016,"Path (Imported From)"="/Users/Nik/Downloads",description="Chlamydomonas pseudogloeogama strain LCR-T2A ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="seqdump (2).txt","Molecule Type"="DNA",Created=Fri Jun 03 10:09:23 EDT 2016] 'Chlamydomonas_raudensis_gb|JF439459.1|'[&URN="urn:local:.:jd-677xlgi",%GC=41.9%,Modified=Mon Jun 06 18:32:44 EDT 2016,"Path (Imported From)"="/Users/Nik/Downloads",description="Chlamydomonas raudensis isolate SAG 49.72 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="seqdump (2).txt","Molecule Type"="DNA",Created=Fri Jun 03 10:09:23 EDT 2016] 'Chlamydomonas_reinhardtii__BK000554.2_' Chlamydomonas_tetragama__AJ001880_NIES_446_ Chlamydomonas_applanata Chlamydomonas_nivalis Chlamydopodium_vacuolatum_EF113426__UTEX_2111 'Chlorochytrium_lemnae_emb|HE860264.1|'[&URN="urn:local:.:7m-677vef0",%GC=42.0%,Modified=Mon Jun 06 18:39:57 EDT 2016,"Path (Imported From)"="/Users/Nik/Downloads",description="Chlorochytrium lemnae partial rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, culture collection CAUP:H6901","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="seqdump.txt","Molecule Type"="DNA",Created=Fri Jun 03 09:58:59 EDT 2016] 'Chlorococcum_ellipsoideum_gb|EF113431.1|'[&URN="urn:local:.:7b-677vef0",%GC=40.2%,Modified=Mon Jun 06 18:28:29 EDT 2016,"Path (Imported From)"="/Users/Nik/Downloads",description="Chlorococcum ellipsoideum strain UTEX 972 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="seqdump.txt","Molecule Type"="DNA",Created=Fri Jun 03 09:58:59 EDT 2016] 'Chlorococcum_sp.__JQ415923.1_LU9_' Chlorococcum_tatrense 'Chlorogonium_capillatum__AB010233__CCAP_12/5_' Chlorogonium_elongatum__AB206329__SkCl_2_ Chloromonas_serbinowi_AJ001879 Chloromonas_perforata Chloromonas_rosae Chlorosarcinopsis_arenicola_AB451192__UTEX_1697 'Chlorosarcinopsis_sp._A_KF_2011_strain_BCP_EM1VF1_gb|HQ246341.1|'[&URN="urn:local:.:7k-677vef0",%GC=42.9%,Modified=Mon Jun 06 18:32:08 EDT 2016,"Path (Imported From)"="/Users/Nik/Downloads",description="Chlorosarcinopsis sp. A KF-2011 strain BCP-EM1VF1 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="seqdump.txt","Molecule Type"="DNA",Created=Fri Jun 03 09:58:59 EDT 2016] Chlorosarcinopsis_eremi Dunaliella_primolecta__AB127992__TS_3_ Dunaliella_viridis_UTEX_1983_AJ001877 Dunaliella_salina Dysmorphococcus_globosus__AJ001885_SAG20_1_ 'Fusochloris_perforata_UTEX_2104_EF113438.1' Gonium_pectorale 'Gungnir_kasakii_CCAP_12/8_AB010244' Gungnir_neglectum_IkCl_701_AB360756 'Heterochlamydomonas_inaequalis_SAG_4.75_EF113448' 'Microthamnion_kuetzingianum_CCAP_450/1b_EF589152.1' 'Oophila_sp._CT_2013c_469'[&URN="urn:local:.:lt-678bf67",%GC=38.3%,Modified=Mon Jun 06 18:25:11 EDT 2016,"Path (Imported From)"="/Users/volvox/Downloads",description="Oophila sp. CT2013c-469 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="sequence (3).fasta","Molecule Type"="DNA",Created=Fri Jun 03 14:38:36 EDT 2016] 'Oophila_sp._CT2013b_310'[&URN="urn:local:.:lw-678bf68",%GC=39.1%,Modified=Mon Jun 06 18:24:57 EDT 2016,"Path (Imported From)"="/Users/volvox/Downloads",description="Oophila sp. CT2013b-310 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit gene, partial cds; chloroplast","# Nucleotide Sequences With Quality"=0,Topology="linear","Filename (Imported From)"="sequence (3).fasta","Molecule Type"="DNA",Created=Fri Jun 03 14:38:36 EDT 2016] 'Pascherina_tetrasm_AB542929.1' Paulschulzia_pseudovolvox_D86825 'Pleurastrum_insigne_SAG_30.93_EF113464.1' Pseudotetracystis_UTEX1927 Tetracystis_aeria__EF113476__UTEX_1453_ 'Tetraspora_sp.__EF113477__UTEX_LB_234_' Volvox_carteri_D6344 ; end; begin characters; dimensions nchar=1467; format datatype=dna missing=? gap=-; matrix '2015.303.rbcL_MSF_#11_c2e2_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGATGTTCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATAATTATATCGAGAAAGATCGTAGCCGTGGTATTTACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ '2015.298.rbcL_MSF_#11_c2e1_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATAATTTTATCGAGAAAGATCGTAGCCGTGGTATTTACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ '2015.299.rbcL_MSF_#11_c2e1_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATAATTATATCGAGAAAGATCGTAGCCGTGGTATTTACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ '2015.301.rbcL_MSF_#11_c2e2_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATAATTTTATCGAGAAAGATCGTAGCCGTGGTATTTACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ '2015.302.rbcL_MSF_#11_c2e2_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATA-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- '2015.304.rbcL_MSF_#11_c3e1_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATAATTATATCGAGAAAGATCGTAGCCGTGGTATTTACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ '2015.305.rbcL_MSF_#11_c3e1_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGAT--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- '2015.306.rbcL_MSF_#11_c3e2_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTG----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- '2015.307.rbcL_MSF_#11_c3e3_consensus' ---------------------------------------------------------------------------------------------------------------------------------------------GATATTTTAGCAGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTTGCAGCTGAATCTTCTACTGGTACTTGGACTACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGATAATCAATTTATCGCTTATGTTGCTTATCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCTTATGTTAAAACTTTCTCTGGTCCTCCTCACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTTCCAATTATCATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCTATGCATGCTGTAATCGATCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACATTCTGGTACAGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATAATTATATCGAGAAAGATCGTAGCCGTGGTATTTACTTT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carteria_radiosa__D89770_ ---------------------------------------------------------------------GCTGGGTTTAAAGCTGGTGTTAAAGATTATCGATTAACGTATTATACACCAGATTACGTAGTGAAAGACACTGATATTTTAGCTGCTTTCCGTATGACTCCACAACCAGGTGTTCCACCAGAAGAATGTGGTGCAGCTGTTGCAGCTGAATCATCAACAGGTACTTGGACAACTGTATGGACTGACGGTTTAACATCTTTAGATCGTTATAAAGGTCGTTGTTACGATATCGAACCTGTACCAGGGGAAGATAACCAATATATTGCTTATGTAGCATACCCAATTGACCTTTTTGAAGAAGGTTCTGTAACAAACTTATTAACTTCAATTGTAGGTAACGTTTTTGGTTTCAAAGCATTACGTGCATTACGTTTAGAAGATCTTCGTATTTCTTCTGCTTATGCTAAAACATTCCAAGGACCTCCACATGGTATTCAAGTAGAACGTGATAAACTAAACAAATATGGTCGTGGTTTATTAGGTTGTACTATTAAACCAAAACTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGACTTTACAAAAGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGCGTGACCGTTTCCTTTTCGTAGCTGAAGCTACTTATAAAGCACAAACAGAAACAGGTGAAATTAAAGGACACTACCTTAACGCTACAGCAGCAACTTGTGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGAATTAGGTGTACCTATTATTATGCACGACTATATCACAGGTGGTTTCACAGCTAACACATCATTAGCTCACTACTGTAGAGATCATGGTCTTTTACTACACATCCACCGTGCTATGCACGCTGTTATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTCTAGCTAAATGTCTTCGTATGTCTGGTGGTGACCACTTACACTCAGGAACTGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGATTTAATGCGTGACGATTATATCGAAAAAGATAGAAGTCGTGGTATTTATTTCACACAAGATTGGTGTTCACTTCCAGGTGTTATGCCAGTTGCTTCTGGTGGTATTCACGTTTGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Carteria_cerasiformis ATGATAGAATCGACAACAAAGTTGTCATTAGACGATATAATGGTACCACAAACTGAAACCAGAGCAGGTGCAGGATTTAAAGCAGGGGTTAAAGATTACCGATTAACGTATTATACTCCTGATTATGTTGTAAAAGAAACGGATATTTTAGCTGCATTCCGTATGACTCCACAACCAGGTGTTCCACCAGAAGAATGTGGAGCTGCTGTAGCTGCTGAATCAAGTACTGGTACTTGGACAACAGTATGGACTGATGGATTAACATCTCTAGATCGCTACAAAGGGCGTTGCTATGACATCGAACCTGTTCCTGGTGAAGAAAACCAATACATTGCTTATGTAGCATACCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACATCAATTGTAGGTAACGTATTCGGATTTAAAGCACTTCGTGCTTTACGTTTAGAAGATTTACGTATTTCTCCAGCATATGTTAAAACATTCCAAGGTCCTCCTCACGGTATCCAAGTAGAACGTGATAAAATTAACAAATATGGTAGAGGTCTTTTAGGTTGTACTATTAAACCAAAATTAGGTTTATCTGCTAAAAACTATGGACGTGCTGTTTACGAATGTTTACGTGGTGGTCTTGACTTTACTAAAGATGATGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTATAAAGCACAAGGTGAAACTGGTGAAATTAAAGGTCACTATTTAAATGCTACTGCAGGTACTTGTGAAGAAATGATCAAACGTGCTCAATGTGCTAAGGAGCTTGGAGTACCGATCATCATGCATGACTACCTAACAGGTGGTTTCACAGCTAACACATCATTAGCAGAATATTGCCGTGATCATGGTCTATTATTACACATTCACCGTGCTATGCACGCTGTTATTGACCGTCAAAGAAATCACGGTATTCACTTCCGTGTATTAGCAAAAGCTCTTCGTATGTCAGGTGGTGACCACTTACACTCAGGAACTGTTGTTGGTAAATTAGAAGGTGAACGTGAAGTTACTTTAGGATTTGTTGATTTAATGCGTGACGATTATGTTGAAAAAGATCGTAGTCGTGGTATTTATTTCACACAAGACTGGGTTTCTATGGCTGGGGTTATGCCTGTAGCTTCTGGTGGTATTCACGTTTGGCACATGCCAGCATTAGTTGAAATCTTCGGTGATGACGCTTGTTTACAATTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCACCAGGTGCGGCTGCTAACCGTGTAGCTCTAGAAGCTTGTACTCAAGCTCGTAACGAAGGTCGCGATTTAGCTCGTGAAGGTGGCGATGTTATTCGTTCAGCTTGCCGTTGGAGTCCTGAACTAGCTGCTGCTTGTGAAGTTTGGAAAGAAATCAAATTCGAATTTGAAACAATTGATAAACTATAA Carteria_sp_SAG_8_5 ---------------------------------------ATGGTTCCACAAACAGAAACCAAAGCAGGTGCCGGGTTTAAAGCTGGTGTGAAAGATTACCGTTTAACATATTACACTCCAGATTACGTTGTAAAAGATACTGATATCTTAGCAGCTTTCCGTATGACTCCACAACCTGGTGTTCCACCTGAAGAATGTGGTGCAGCGGTTGCAGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACTGACGGTTTAACTTCTCTAGACCGTTACAAAGGACGTTGTTACGATATCGAGCCAGTTCCAGGTGAAGAAAACCAATACATCGCTTATGTTGCTTACCCAATCGATCTTTTCGAAGAAGGTTCAGTAACTAACTTACTAACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTTTAGAAGATATCCGTATTTCTGCTGCTTACGCTAAAACTTTCCAAGGACCTCCTCACGGGATCCAAGTTGAACGTGACAAACTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCTAAACTAGGTCTTTCAGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTCTAGACTTCACTAAAGATGACGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGTGACCGTTTCCTTTTCGTTTCTGAAGCTATCTACAAATCACAAGCTGAAACAGGTGAAATTAAAGGACACTACCTTAACGCTACTGCAGCTACTTGTGAAGAAATGATGAAACGTGCACAATGTGCTAAAGAATTCGGTGTTCCGATTATTATGCATGACTACATTACTGGTGGTTTCACTGCTAACACTTCTTTATCTCACTACTGTCGTGACCACGGTCTATTATTACACATCCACCGTGCTATGCACGCTGTTATTGACCGTCAAAGAAACCACGGTATCCACTTCCGTGTTCTAGCTAAATGTCTACGTATGTCTGGTGGTGACCACTTACACTCTGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACCTAATGCGTGACGACTACATCGAAAAAGATCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCTCTACCAGGTGTTATGCCAGTTGCTTCTGGTGGTATTCACGTTTGGCACATGCCAGCTCTAGTTGAAATTTTCGGTGATGACGCTTGTTTACAATTTGGTGGTGGTACACTAGGACACCCATGGGGTAACGCTCCAGGTGCTGCTGCTAACCGTGTTGCTTTAGAAGCTTGTACACAAGCTCGTAACGAAGGTCGTGACCTTGCTCGCGAAGGTGGAGATGTTATCCGCTCAGCTTGCAAATGGTCTCCAGAACTTGCTGCTGCTTGTGAAGTTTGGAAAGAAATCAAATTTGAATTCGAAACTATTGACAAACTTTAA Characiochloris_acuminata_NIES_637_AB360752 -----------------------------------------------------------TAAAGCAGGCGCTGGCTTCAAAGCAGGTGTTAAAGACTATCGTTTAACATATTACACACCTGATTACGTAGTAAAAGAAACTGATATTTTAGCTGCATTCCGTATGACTCCACAACCAGGTGTTCCACCTGAAGAATGTGGTGCTGCTGTTGCTGCTGAATCTTCAACAGGTACTTGGACTACTGTATGGACAGATGGTTTAACTAGTTTAGACCGTTACAAAGGTCGTTGCTATGACATCGAGCCAGTTCCAGGTGAAGAAAACCAATATATCGCATACGTAGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTTACTAACATGTTCACATCTATCGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTACGTTTAGAAGACCTTCGTATCCCTCCAGCTTACGTTAAAACATTCGCTGGTCCTCCTCACGGTATTCAGGTTGAACGTGATAAAATTAACAAATACGGTCGTGGTTTATTAGGTTGTACAATTAAACCTAAGTTAGGTCTTTCAGCTAAAAACTACGGACGTGCTGTTTACGAGTGTTTACGTGGTGGTTTAGACTTTACTAAAGACGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTGCTGAAGCTATTTACAAAGCACAAGCTGAAACAGGTGAAGTAAAAGGTCACTACTTAAACGCAACTGCAGCTACTGCTGAAGAAATGCTTAAACGTGCACAATGTGCTAAAGAGTTAGGTGTACCTATTATTATGCATGACTATTTAACAGGTGGTTTCACTGCTAACACTTCTTTAGCAGCTTACTGCCGTGACCACGGTTTATTATTACACATCCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATCCACTTCCGTGTTCTAGCTAAAGCTCTACGTATGTCAGGTGGTGACCACCTTCACTCTGGTACTGTAGTAGGTAAACTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGATTTAATGCGTGACGACTACGTTGAAAAAGATCGTAGCCGTGGTATTTACTTCACACAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCACATGCCTGCTCTAGTAGAGATCTTCGGTGACGACGCATGTTTACAGTTCGGTGGTGGTACTCTTGGTCACCCTTGGGGTAACGCTCCTGGTGCTGTTGCTAACCGTGTTGCTCTTGAAGCTTGTACTCAAGCTCGTAACGAAGGACGTGACCTT-GCTCGTGAAGGTGGCGACGTTATC-CGTT-CTGCTTGCAAATGGAGTCCAGAATTAGCTGCTGCTT-------------------------------------------------- 'Chlainomonas_rubra__DQ885969.2_' ---------------------------------------------------------------------GCAGGTTTTAAAGCTGGTGTTAAAGATTATCGTTTAACATATTACACTCCTGATTACGTTGTAAAAGATACAGACATTCTTGCAGCTTTCCGTATGACTCCTCGAGCGGGCGTTCCAATTGAAGAAGCTGGTGCAGCTGTTGCAGCAGAATCTTCTACTGGTACTTGGACTACTGTATGGACTGATGGTTTAACAAGTCTTGACCGTTACGAAGGTCGTTGTTATGACATCGAACCAGTTGCAGGTGAAGAAAACCAATACATTGCTTACGTTGCTTACCCTATCGACTTATTTGAAGAAGGTTCTGTAACTAACTTATTCACGTCAATTGTTGGTAACGTTTTTGGTTTCAAAGCTCTTCGTGCTCTTCGTCTTGAAGATTTACGTATTTCTTGTGCTTATGCTAAAACATTCCAAGGACCTCCTCACGGTATCCAAGTAGAACGTGACAAATTAAACAAATACGGACGTGGTCTTTTAGGCTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTATGGTCGTGCTGTTTACGAATGTTTGCGTGGTGGTTTAGATTTTACGAAAGACGATGAAAACGTAACATCTCAAGCTTTCATGCGTTGGAGAGACCGTTTTATCTTCGTTGCTGAAGCTCTTTACAAATCTCAAGCTGAAACTGGCGAAATTAAAGGTCACTACCTTAACGTAACTGCTGGTACATCAGAAGAAATGCTAAAACGTGCTGAAGTAGCTAAAGATTTAGGGGTACCAATCATCATGCATGACTACTTAACTGGTGGTTTAACTGCAAACACTTCATTAGCTCACTACTGTCGTGACAACGGTCTATTACTACACATTCACAGAGCTATGCACGCGGTTATTGACCGTCAAAGAAACCACGGTATCCATTTCCGTGTTCTAGCTAAAGCTCTTCGTCTGTCAGGTGGTGACCACCTTCACTCAGGAACAGTTGTAGGTAAACTAGAAGGGGAACGTGAAGTTACTCTTGGTTTCGTTGATTTAATGCGTGACGAATACATCGAAAAAGACCGTAGCCGTGGTATTTATTTCACACAAGACTGGTGTGGTTTACCGGGCGTTATGCCTGTAGCTTCAGGTGGTATCCACGTATGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Chlamydomonas_acidophila__KT_1__AB127986.1_' -----------------------------------------------------------AAAAACAGGTGCTGGCTTCAAAGCTGGAGTTAAAGATTACCGTTTAACATACTATACTCCGGATTACGTAGTTAAAGATACTGATATTTTAGCTGCTTTCCGTATGACTCCACAACCTGGTGTTCCTACAGAAGAATGTGGTGCAGCTGTAGCAGCTGAATCTTCAACTGGTACTTGGACAACAGTTTGGACTGATGGATTAACAAGTCTTGACCGTTACAAAGGTCGTTGTTACGATATCGAACCAGTTCCAGGTGAAGATAACCAATTTATCGCTTATATTGCTTACCCAATCGACTTATTTGAAGAAGGTTCAGTAACTAACCTTTTCACTTCAATTGTTGGTAACGTATTTGGTTTCAAAGCATTACGTGCACTTCGTTTAGAAGACTTACGTATTCCTCCAGCATACGTTAAAACATTCTTAGGACCACCTCATGGTATCCAAGTAGAACGTGACAAACTTAACAAATATGGACGTGGTTTATTAGGTTGTACGATTAAACCAAAATTAGGTTTATCAGCTAAAAACTATGGTCGTGCTGTTTATGAATGTTTACGTGGTGGTCTTGATTTTACTAAAGATGACGAAAACGTTACATCTCAACCATTCATGCGTTGGCGTGACCGTTTCCTTTTCTGTGCTGAGGCTATTTACAAATCTCAAGCGGAAACAGGTGAAGTAAAAGGACACTATTTAAACTGTACAGCAGGTACTTCTGAAGAAATGCTTAAACGTGCTGCTTGTGCTAAAGATTTTGGTGTTCCAATTATCATGCATGACTACCTTACTGGTGGTTTTACTTCTAATACTTCATTAGCTAACTACTGTCGTGACGAAGGTTTATTACTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAACGTAACCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACCTTCACTCAGGTACAGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTTACATTAGGTTTCGTTGACTTAATGCGTGATAACTATATCGAAAAAGACCGTAGCCGTGGTATCTACTTTACTCAAGATTGGGCTTCAATGAGAGGTGTTATGCCTGTGGCCTCAGGGGGAATTCACGTATGGCATATGCCAGCATTAGTTGAAATCTTCGGTGATGACGCTTGTTTACAATTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCACCTGGTGCTGTTGCTAACCGTGTTGCTTTAGAAGCTTGTACACAAGCTCGTAATGAAGGTAGAGATTTAGCTCGCGAAGGTGGAGATGTTATCCGTTCAGCTTGTAAATGGTCTCCAGAATTAGCAGCTGCTTGTGAG------------------------------------------------ 'Chlamydomonas_gloeophila_strain_UTEX_608_gb|KJ635656.1|' -----------------------------------------------------------------------------------------------------------------------AGATTACGTTGTAAAAGATACTGATATTTTAGCTGCATTCCGTATGACTCCACAACCAGGTGTTCCACCTGAAGAGTGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGTTTAGATCGTTACAAAGGACGTTGTTACGACATCGAACCCGTGCCTGGAGAGGATAACCAGTACATTGCTTATGTAGCTTACCCAATCGATTTATTCGAAGAAGGTTCAGTTACTAACTTATTCACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTTTACGTCTTGAAGATCTTCGTATCCCTCCTGCTTACGTTAAAACGTTCTCAGGTCCTCCACATGGTATTCAAGTTGAACGTGACAAATTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCAAAATTAGGTTTATCTGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGACTTTACAAAAGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTGCTGAAGCTATTTACAAATCACAAGCTGAAACTGGTGAAGTAAAAGGTCACTATTTAAACGCTACAGCTGGTACAGCTGAAGAAATGTTAAAACGTGCAGTATGTGCTAAAGAATTAGGGGTACCAATCATTATGCATGACTACCTAACAGGTGGTTTCACTGCTAACACTTCATTAGCTATCTACTGTCGTGATCATGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTTATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCTTTACGTATGTCTGGTGGTGACCATTTACACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACATTAGGTTTCGTAGACTTAATGCGTGATGACTACATCGAAAAAGATCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTTATGCCAGTTGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTTGAAATCTTTGGTGATGACGCATGTTTACAGTTCGGTGGTGGTACTCTTGGTCACCCTTGGGGTAACGCTCCTGGTGCTGTTGCAAACCGTGTTGCTTTAGAAGCTTGTACACAAGCTCGTAACGAAGGTC----------------------------------------------------------------------------------------------------------------------------- 'Chlamydomonas_moewusii_UTEX_97_gb|EF587479.1|' ---------------------------------------ATGGTTCCTCAAACAGAAACAAAAGCCGGTGCTGGGTTTAAAGCAGGTGTAAAAGATTATCGTCTTACTTATTATACACCAGATTACGTAGTAAAAGATACTGATATTTTAGCTGCATTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCAGTAGCTGCTGAATCTTCAACAGGTACTTGGACTACAGTATGGACGGATGGTTTAACAAGCTTAGACCGTTATAAAGGACGTTGTTACGATATCGAACCAGTTCCTGGGGAAGATAACCAATACATCGCGTATGTTGCATACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACTTATTTACATCTATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCACTACGTCTAGAAGATTTACGTATCCCTCCAGCATATGTTAAAACATTCTCTGGACCTCCACACGGTATCCAAGTAGAACGTGACAAAATTAACAAATACGGACGTGGTCTTTTAGGTTGTACAATTAAGCCTAAATTAGGTCTTTCAGCTAAAAACTATGGACGTGCTGTTTACGAATGTCTACGTGGTGGACTTGACTTTACTAAGGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGCGTGACCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGAGAAGTAAAAGGGCATTACTTAAACGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCAGTTTGTGCTAAAGAATTCGGTGTACCTATTATTATGCATGACTATTTAACAGGTGGATTCACAGCTAACACTTCATTATCGAACTACTGTCGTGACCACGGTTTATTATTACACATTCACCGTGCAATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATCCACTTCCGTGTTTTAGCTAAAGCTCTACGTATGTCAGGTGGTGACCACCTACACTCTGGAACTGTAGTAGGTAAACTAGAAGGTGAGCGTGAAGTAACATTAGGTTTCGTAGACTTAATGCGTGATAACTACATTGAAAAAGACCGTAGCCGTGGTATTTACTTTACACAAGACTGGTGTTCAATGGCAGGAGTTATGCCTGTAGCTTCAGGTGGTATTCACGTATGGCATATGCCAGCTTTAGTTGAAATCTTTGGTGATGACGCTTGTTTACAATTCGGTGGTGGTACTTTAGGACACCCTTGGGGTAACGCTCCTGGTGCTGTTGCTAACCGTGTAGCTCTTGAAGCTTGTACACAAGCTCGTAACGAAGGTCGTGACTTAGCTCGTGAAGGTGGAGATGTAATCCGTTCAGCTTGTAAATGGTCGCCTGAATTAGCAGCGGCTTGTGAAGTATGGAAAGAAATTAAATTCGAATTTGATACTATTGACAAACTTTAA 'Chlamydomonas_pseudogloeogama_gb|EF589142.1|' ---------------------------------------------------------------------GCTGGGTTTAAAGCAGGTGTAAAAGATTATCGTCTTACATATTATACACCAGATTATGTTGTAAAAGATACTGATATTTTAGCAGCGTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTAGCAGCAGAATCATCAACTGGTACTTGGACAACAGTTTGGACAGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAGCCTGTTCCAGGAGAAGATAATCAATTTATCGCTTATGTTGCATACCCAATCGATTTATTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCTTGAAGATCTTCGTATTCCTCCAGCATATGTTAAAACTTTCTCTGGACCTCCTCACGGTATCCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTCTAGATTTCACTAAAGATGATGAAAACGTTAACTCTCAACCATTTATGCGTTGGCGTGACCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACAGGTGAAGTTAAAGGTCATTACTTAAATGCTACTGCTGGTACTTCTGAAGAAATGATCAAACGTGCAGTTTGTGCTAAAGAATTTGGTGTACCAATTATTATGCATGACTATATTACTGGTGGTTTTACTGCTAACACTTCATTAGCTCTTTACTGTCGTGATCATGGTTTATTATTACATATTCACCGTGCAATGCATGCTGTTATTGACCGTCAAAGAAATCACGGTATTCACTTCCGTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACTTACACTCTGGTACTGTAGTTGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATAATTATATCGAAAAAGATCGTAGCCGTGGTATTTACTTTACTCAAGATTGGGCTTCTATGGCAGGTGTTATGCCAGTTGCTTCTGGTGGTATTCACGTTTGGCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Chlamydomonas_raudensis_gb|JF439459.1|' ---------------------------------------ATGGTCCCTCAAACAGAAACAAGAGCTGGTGCTGGGTTTAAAGCAGGTGTAAAAGACTACCGTCTTACATATTATACACCAGATTACGTTGTAAAAGATACTGATATTTTAGCTGCATTCCGTATGACTCCACAACCTGGTGTTCCAGCTGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACTTGGACAACAGTATGGACTGATGGTTTAACAAGCTTAGACCGTTATAAAGGACGTTGTTACGACATCGAGCCTGTTCCAGGAGAAGACAACCAATATATCGCTTACGTTGCTTACCCAATCGACTTATTCGAAGAAGGATCAGTAACTAACTTATTTACTTCAATTGTAGGTAACGTATTTGGATTCAAAGCGTTACGTGCTCTACGTTTAGAAGATTTACGTATCCCTCCTGCATACGTTAAAACTTTCTCTGGACCTCCTCACGGTATCCAAGTAGAACGTGACAAAATTAACAAATATGGTCGTGGTTTATTAGGTTGTACAATTAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGACGTGCTGTTTACGAATGTTTACGTGGTGGGTTAGACTTTACGAAGGATGACGAAAACGTTAACCCACAACCATTTATGCGTTGGCGTGACCGTTTCTTATTCTGTGCTGAAGCTATCTATAAAGCTCAATCTGAAACTGGTGAAGTAAAAGGTCACTACTTAAACGCTACAGCTGCTACGTCTGAAGAAATGATCAAACGTGTAGTTTGTGCTAAAGAATTCGGAGTGCCAATTATCATGCATGACTACTTAACTGGTGGGTTTACTGCTAACACTTCATTATCTAACTACTGTCGTGACCACGGTTTATTATTACACATTCACCGTGCAATGCACGCTGTAATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCTTTACGTCTTTCAGGTGGTGACCACTTACACTCTGGTACTGTAGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTTGTAGACTTAATGCGTGATAACTACGTTGAAAAAGACCGTAGCCGTGGTATTTACTTTACTCAAGACTGGTGTTCAATGGGTGGTGTAATGCCAGTAGCTTCTGGTGGTATCCACGTATGGCACATGCCAGCTTTAGTTGAAATCTTCGGTGATGACGCTTGTTTACAGTTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCTCCAGGTGCTGTAGCTAACCGTGTTGCTTTAGAAGCTTGTACACAAGCTCGTAACGAAGGTCGTGACTTAGCTCGTGAAGGTGGAGATGTAAT---------------------------------------------------------------------------------------------- 'Chlamydomonas_reinhardtii__BK000554.2_' ---------------------------------------ATGGTTCCACAAACAGAAACTAAAGCAGGTGCTGGATTCAAAGCCGGTGTAAAAGACTACCGTTTAACATACTACACACCTGATTACGTAGTAAGAGATACTGATATTTTAGCTGCATTCCGTATGACTCCACAACTAGGTGTTCCACCTGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACATGGACTACAGTATGGACTGACGGTTTAACAAGTCTTGACCGTTACAAAGGTCGTTGTTACGATATCGAACCAGTTCCGGGTGAAGACAACCAATACATTGCTTACGTAGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACATGTTCACTTCTATTGTAGGTAACGTATTCGGTTTCAAAGCTTTACGTGCTCTACGTCTTGAAGACCTTCGTATTCCACCTGCTTACGTTAAAACATTCGTAGGTCCTCCACACGGTATTCAGGTAGAACGTGACAAATTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCAGTTTATGAATGTTTACGTGGTGGTCTTGACTTTACTAAAGACGACGAAAACGTAAACTCACAACCATTCATGCGTTGGCGTGACCGTTTCCTTTTCGTTGCTGAAGCTATTTACAAAGCTCAAGCAGAAACAGGTGAAGTTAAAGGTCACTACTTAAACGCTACTGCTGGTACTTGTGAAGAAATGATGAAACGTGCAGTATGTGCTAAAGAATTAGGTGTACCTATTATTATGCACGACTACTTAACAGGTGGTTTCACAGCTAACACTTCATTAGCTATCTACTGTCGTGACAACGGTCTTCTTCTACACATCCACCGTGCTATGCACGCGGTTATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTTCTTGCTAAAGCTCTTCGTATGTCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTTACTCTAGGTTTCGTAGACTTAATGCGTGATGACTACGTTGAAAAAGACCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTTATGCCAGTTGCTTCAGGCGGTATTCACGTATGGCACATGCCAGCTTTAGTTGAAATCTTCGGTGATGACGCATGTCTTCAGTTCGGTGGTGGTACTCTAGGTCACCCTTGGGGTAACGCTCCAGGTGCTGCAGCTAACCGTGTAGCTCTTGAAGCTTGTACTCAAGCTCGTAACGAAGGTCGTGACCTTGCTCGTGAAGGTGGCGACGTAATTCGTTCAGCTTGTAAATGGTCTCCAGAACTTGCTGCTGCATGTGAA------------------------------------------------ Chlamydomonas_tetragama__AJ001880_NIES_446_ ---------------------------------------------------------------------GCTGGGTTTAAAGCAGGTGTAAAAGATTATCGTCTTACATATTATACTCCAGACTACGTTGTAAGAGATACTGATATTCTTGCAGCATTCCGTATGACTCCTCAACCAGGTGTTCCACCAGAAGAGTGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACTGACGGTTTAACTAGCTTAGATCGTTATAAAGGTCGTTGTTATGATATCGAACCAGTTCCTGGTGAAGATAACCAATATATTGCTTATGTTGCTTACCCAATCGATTTATTCGAAGAAGGTTCAGTAACTAACTTATTCACTTCTATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCTCTACGTCTTGAAGATCTTCGTATTTCTCCAGCTTATGTTAAAACATTTGGTGGACCTCCACACGGTATTCAAGTAGAACGTGACAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCAAAATTAGGTCTTTCAGCTAAAAACTACGGACGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGACTTCACAAAAGATGACGAAAACGTAACTTCACAACCATTCATGCGTTGGAGAGACCGTTTCCTTTTCGTTGCTGAAGCTATCTATAAAGCTCAAGCCGAAACTGGTGAAGTTAAAGGTCACTATTTAAACGCTACTGCAGGTACTGCAGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGAATTAGGTGTACCTATTATTATGCACGACTATTTAACAGGTGGTTTCACAGCTAACACTTCATTAGCTGCTTACTGCCGTGACCACGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATCCACTTCCGTGTTCTTGCTAAAGCTCTACGTATGTCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACTTAATGCGTGATGACTACGTTGAAAAAGACCGTAGCCGTGGTATTTACTTCACTCAAGATTGGTGTTCAATGCCAGGTGTTATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Chlamydomonas_applanata ---------------------------------------ATGGTTCCACAAACAGAAACAAGAGCAGGTGCTGGATTTAAAGCAGGTGTTAAAGACTACCGTCTTACATACTACACTCCAGATTACGTTGTAAGAGATACTGATATTTTAGCTGCATTCCGTATGACTCCACAACCAGGTGTTCCACCTGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGCTTAGACCGTTACAAAGGTCGTTGTTACGACATCGAGCCAGTTCCAGGTGAAGACAACCAATACATCGCTTACGTTGCTTACCCAATCGATTTATTCGAAGAAGGTTCAGTAACTAACATGTTCACTTCAATCGTTGGTAACGTATTCGGTTTCAAAGCTTTACGTGCTCTACGTCTTGAAGATTTACGTATTCCTCCAGCTTACGTTAAAACATTCGGTGGTCCTCCACACGGTATTCAGGTTGAACGTGACCGTTTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGACTTTACAAAAGATGACGAAAACGTTAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTGCTGAAGCTATCTACAAATCACAAGCTGAAACTGGTGAAGTTAAAGGTCACTACTTAAACGCTACTGCAGCTACTTCTGAAGAAATGATCAAACGTGCTGTATGTGCTAAAGAATTCGGTGTACCTATTATTATGCATGACTACTTAACAGGTGGTTTCACTGCTAACACTTCATTAGCTGCTTACTGTCGTGATCACGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAACGTAACCACGGTATCCACTTCCGCGTATTAGCTAAAGCTTTACGTTTATCAGGTGGTGACCACTTACACTCAGGTACAGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACATTAGGTTTCGTAGACTTAATGCGTGACGACTACATCGAAAAAGACCGTAGCCGTGGTATCTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCACATGCCAGCTCTAGTTGAGATCTTCGGTGATGACGCTTGTTTACAGTTCGGTGGTGGTACTCTAGGTCACCCTTGGGGTAACGCTCCTGGTGCTGTTGCTAACCGTGTAGCGTTAGAAGCTTGTACTCAAGCTCGTAACGAAGGTCGCGATTTAGCACGCGAAGGCGGCGACGTAATTCGTTCTGCATGCAAATGGAGTCCTGAATTAGCAGCTGCTTGTGAAGTTTGGAAAGAAATTAAGTTCGAATTCGATACTATCGACAAACTTTAA Chlamydomonas_nivalis ---------------------------------------ATGGTTCCTCAAACACAAACTAGGGTTGGTGCAGGTTTTAAAGCTGGTGTTAAAGATTATCGTTTAACATATTATACTCCTGATTACGTTGTAAGAGAAACAGATATTCTTGCTGCATTCCGTATGACTCCACAAGCTGGTGTTCCTATCGAAGAAGCAGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACATGGACAACTGTATGGACTGATGGTTTAACAAGTCTTGACCGTTATAAAGGTCGTTGTTATGATATCGAACCAGTTGCTGGTGAAGATAATCAATATATCGCTTACGTTGCATACCCTATCGAATTATTTGAAGAAGGTTCTGTAACTAGTTTATTAACATCTATTGTTGGTAACGTTTTTGGTTTCAAAGCTCTTCGTGCTCTACGTCTTGAAGATTTACGTATTTCTACTGCATATTGTAAATCATTCCAAGGACCTCCTCACGGTATTCAAGTAGAACGTGACAAATTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACTATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGACGTGCTGTTTATGAATGTTTACGTGGTGGACTTGACTTCACGAAAGATGACGAAAACGTTACTTCTCAATCATTTATGCGTTGGAGAGACCGTTTTATTTTCGTTGCTGAAGCTCTTTACAAATCTCAAGCTGAAACTGGTGAAATTAAAGGTCACTATTTAAACGCTACTTCAGGAACTGCTGAAGAAATGTTAAAACGTGCAGAAGTTGCTAAAGACTTAGGTGTACCTATCATCATGCATGACTATTTAACAGGTGGTTTAACAGCTAATACATCATTAGCACACTACTGTCGTGATAATGGTTTATTATTACACATTCACAGAGCTATGCACGCGGTTATTGACCGTCAAAGAAACCATGGTATGCACTTCCGTGTTTTAGCTAAAGCTCTACGTCTATCAGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAACTTGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGATTTAATGCGTGATGAATACATTGAAAAAGACCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTGGTTTAGGTGGTGTTATGCCAGTTGCATCTGGTGGTATCCACGTATGGCATATGCCTGCTTTAGTTGAAATCTTCGGTGATGACGCTTGTCTTCAATTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCTCCTGGTGCTGCAGCTAACCGTGTAGCTCTAGAAGCTTGTACACAAGCTCGTAATGAAGGACGTGATTTAGCACGTGAAGGTGGAGATGTAATCCGCTCAGCTTGTAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAAGTTTGGAAAGAAATCAAATTTGAATTTGATACTATTGACAAACTATAA Chlamydopodium_vacuolatum_EF113426__UTEX_2111 ------------------------------------------GTTCCACAAACAGAAACAAGAGCCGGAGCTGGATTCAAAGCCGGTGTAAAAGATTACCGTTTAACATACTACACTCCTGATTACGTTGTAAGAGATACAGATATTTTAGCTGCATTCCGTATGACTCCTCAACCAGGTGTACCACCTGAAGAGTGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGCTTAGATCGTTACAAAGGTCGTTGTTACGATATCGAGCCTGTACCAGGTGAAGATAACCAATACATTGCTTATGTTGCTTACCCAATCGACTTATTTGAAGAAGGTTCAGTAACTAACATGTTTACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCTCTACGTTTAGAAGATTTACGTATTCCTCCAGCTTATGTTAAAACATTTGTTGGTCCTCCACACGGTATTCAGGTAGAACGTGACAAATTAAACAAATATGGCCGTGGTCTTTTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTATGGTCGTGCTGTTTACGAGTGTTTACGTGGTGGTTTAGACTTTACAAAAGATGACGAAAACGTAACATCTCAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTACAAATCTCAAGCTGAAACTGGTGAGGTTAAAGGTCACTACTTAAACGTTACTTCAGGTACTGCTGAAGAAATGTTAAAGAGAGCTCAGTGTGCTAAAGAGTTAGGTGTACCTATTATTATGCATGACTATTTAACGGGTGGTTTTACAGCAAATACATCATTAGCTTACTTCTGTCGTGATAATGGTTTATTATTACACATTCACCGTGCAATGCACGCTGTAATTGACCGTCAAAGAAACCATGGTATTCACTTCCGTGTTTTAGCTAAAGCTTTACGTATGTCAGGTGGTGACCACCTTCACTCAGGTACAGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGATTTAATGCGTGATGATTACGTAGAAAAAGATCGTAGCCGTGGTATTTACTTTACTCAAGACTGGTGTTCAATGCCAGGTGTTATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTAGAAATCTTCGGTGATGACGCTTGTTTACAATTCGGTGGTGGTACATTAGGTCACCCTTGGGGTAACGCACCTGGTGCTGTTGCTAACC----------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Chlorochytrium_lemnae_emb|HE860264.1|' --------------------------------------------------------------------------------------------------CCGTTTAACTTACTACACTCCTGATTACGTTGTAAAAGATACTGATATCTTAGCTGCATTCCGTATGACTCCTCAACCTGGTGTTCCACCAGAAGAGTGTGGTGCTGCTGTAGCTGCTGAATCATCTACAGGTACTTGGACAACTGTATGGACAGATGGTTTAACTAGTTTAGACCGTTACAAAGGTCGTTGTTATGACATCGAGCCGGTGCCTGGTGAGGACAATCAGTACATTGCATATGTTGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACATGTTTACTTCAATTGTTGGTAACGTGTTTGGTTTCAAAGCTTTACGTGCATTACGTCTTGAAGACTTACGTATTCCACCAGCTTACGTTAAAACATTTGCTGGTCCTCCACACGGTATTCAAGTTGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCTAAATTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGATTTCACAAAAGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTACAAATCACAAGCCGAAACAGGTGAAGTTAAAGGTCACTATTTAAACGCTACTGCTGCTACTGCAGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGAATTCGGCGTGCCAATTATTATGCATGACTACTTAACTGGTGGTTTTACGGCTAACACTTCATTAGCTTTATACTGTCGTGACCATGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCTTTACGTATGTCAGGTGGTGACCACTTACACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGACTTAATGCGTGATGATTACGTAGAAAAAGATCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCTGGTGTTATGCCTGTTGCTTCAGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTAGAAATCTTCGGTGATGACGCTTGTTTACAGTTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCACCTGGTGCAGTTGCTAACCGTGTAGCTCTAGAAGCTTGTACTCAAGCTCGTAACGAAGGTCGTGACCTTGCTCGTGAAGGTGGCGACGTAATCCGTACAGCTG----------------------------------------------------------------------------------- 'Chlorococcum_ellipsoideum_gb|EF113431.1|' ------------------------------------------GTTCCACAAACAGAAACAAGAGCTGGTGCTGGGTTTAAAGCCGGTGTAAAAGATTACCGTTTAACTTATTACACTCCTGATTATGTTGTAAGAGATACTGATATTTTAGCTGCATTCCGTATGACTCCTCAACCTGGTGTTCCACCTGAAGAGTGTGGTGCTGCTGTAGCTGCTGAATCATCAACAGGTACTTGGACAACTGTATGGACTGACGGTTTAACTAGCTTAGATCGTTACAAAGGTCGTTGTTATGACATCGAGCCTGTACCTGGGGAAGATAACCAGTACATTGCATATGTTGCATACCCAATCGATTTATTTGAAGAAGGTTCTGTAACAAATATGTTCACATCTATCGTTGGTAACGTATTTGGTTTCAAAGCTTTACGTGCATTACGTTTAGAAGATTTACGTATTCCTCCAGCTTATGTTAAAACATTCTCAGGTCCTCCACATGGTATTCAAGTAGAACGTGATAAAATTAACAAGTATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCTAAATTAGGTCTTTCTGCTAAAAACTATGGTCGTGCTGTTTATGAATGTTTACGTGGTGGTCTTGACTTCACGAAGGATGACGAAAACGTTAACTCACAACCGTTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCAATTTACAAATCACAAGCTGAAACTGGTGAGGTAAAAGGTCACTATTTAAACGCTACTGCTGCTACTTCTGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGAACTAGGTGTGCCGATCATTATGCATGACTATTTAACTGGTGGTTTTACAGCTAACACTTCATTAGCTCTTTACTGTCGTGATCACGGTTTATTATTACACATTCACCGTGCTATGCACGCCGTTATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCATTACGTATGTCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGATTTAATGCGTGACGATTACGTTGAAAAAGACCGTAGCCGTGGTATTTATTTCACTCAAGATTGGTGTTCTATGCCAGGTGTTATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCACA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Chlorococcum_sp.__JQ415923.1_LU9_' ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TACGTATTTGGTTTCAAAGCATTACGTGCATTACGTCTTGAAGATTTACGTATTCCTCCAGCTTATGTTAAAACATTCTCTGGTCCTCCACACGGTATTCAAGTAGAGCGTGATAAAATTAACAAATACGGTCGTGGTCTTTTAGGTTGTACAATTAAACCTAAATTAGGTCTTTCAGCTAAAAACTATGGTCGTGCTGTTTATGAATGTTTACGTGGTGGTCTTGATTTTACTAAAGATGACGAAAACGTTAACTCTCAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTGCTGAAGCTATTTACAAAGCACAATCTGAAACTGGTGAGGTAAAAGGTCACTATTTAAACGCTACAGCTGCTACTGCTGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGAATTAGGTGTACCTATTATTATGCATGACTACTTAACAGGTGGTTTTACAGCTAACACTTCATTATCTCTTTACTGTCGTGATCACGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCATTACGTATGTCTGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGATTTAATGCGTGATGACTACGTTGAAAAAGATCGTAGCCGTGGTATTTACTTCACTCAAGATTGGTGTTCTATGCCAGGTGTAATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCGTTAGTTGAAATTTTCGGTGATGACGCTTGTTTACAGTTCGGTGGTGGTACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Chlorococcum_tatrense ---------------------------------------ATGGTTCCACAAACTGAAACAAGAGCTGGTGCGGGGTTTAAAGCCGGTGTAAAAGATTACCGTTTAACTTATTACACTCCTGATTACGTTGTAAGAGATACTGATATCTTAGCAGCATTCCGTATGACACCTCAAGCAGGTGTTCCACCTGAGGAATGTGGTGCTGCGGTTGCTGCTGAGTCATCGACTGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGCTTAGACCGTTACAAAGGACGTTGTTACGACATCGAACCTGTACCAGGTGAAGACAACCAATACATCGCATATGTAGCATACCCAATCGACTTATTTGAAGAAGGTTCTGTAACAAACATGTTCACTTCTATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCACTACGTCTTGAAGATTTACGTATTCCTCCAGCTTATGTTAAAACATTCTCAGGTCCTCCACACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCTAAATTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTATGAATGTTTACGTGGTGGTCTTGACTTTACTAAAGATGACGAAAACGTAAACTCTCAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTGCAGAAGCATGTTACAAAGCTCAAGCAGAAACAGGTGAGGTTAAAGGGCATTATTTAAACGCTACAGCTGGGACTGCTGAAGAAATGTTAAAAAGAGCTCAATGTGCTAAGGAGTTAGGGGTACCTATCATTATGCATGACTATTTAACTGGTGGTTTTACAGCTAACACTTCATTAGCTTTATACTGTCGTGACCATGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTTATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCATTACGTATGTCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATGATTACGTTGAAAAAGACCGTAGCCGTGGTATTTACTTTACTCAAGACTGGTGTTCTATGCCAGGTGTAATGCCAGTTGCTTCTGGTGGTATTCACGTATGGCACATGCCTGCTTTAGTTGAAATCTTTGGTGATGATGCTTGTTTACAATTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCACCTGGTGCTGTTGCTAACCGTGTAGCTTTAGAGGCTTGTACTCAAGCTCGTAACGAAGGTCGTGACCTTGCTCGCGAAGGTGGAGATGTTATCCGCTCAGCTTGTAAATGGTCTCCTGAATTAGCTGCTGCATGTGAAGTTTGGAAAGAAATCAAATTCGAATTCGATACTATTGACAAACTATAA 'Chlorogonium_capillatum__AB010233__CCAP_12/5_' ---------------------------------------------------------------------GCTGGCTTCAAAGCAGGTGTAAAAGATTACCGTTTAACTTATTACACTCCAGATTACGTTGTAAGAGATACTGATGTATTAGCTGCATTCCGTATGACTCCTCAACCAGGTGTTCCACCTGAAGAGTGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACAGACGGTTTAACTAGCTTAGACCGTTACAAAGGTCGTTGTTACGACATCGAACCAGTTCCAGGTGAAGACAACCAATATATCGCATACGTAGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTTACTAACATGTTCACTTCAATTGTAGGTAACGTATTCGGTTTCAAAGCTTTACGTGCTTTACGTCTTGAAGACCTTCGTATCCCTCCAGCTTATGTTAAAACATTCTCTGGTCCACCACACGGTATTCAGGTTGAACGTGACAAATTAAACAAATATGGTCGTGGTCTTTTAGGGTGTACGATTAAACCAAAATTAGGTTTATCGGCTAAAAATTACGGACGCGCTGTTTATGAATGTTTACGTGGTGGTTTAGACTTCACAAAAGATGACGAAAACGTAACATCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTACAAAGCACAAGCAGAAACTGGTGAAGTAAAAGGTCATTACTTATACGTAACAGCTGGCACAGCTGAAGAAATGCTTAAACGTGCACAATGTGCCAAAGAATTAGGTGTACCTATTATTATGCATGACTATTTAACAGGTGGTTTTACATCTAACACTTCATTAGCGTTATTCTGTCGTGATAACGGTTTATTATTACACATCCACCGTGCTATGCACGCTGTAATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTATTAGCTAAAGCTTTACGTATGTCTGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACTTAATGCGTGATGATTACGTAGAAAAAGACCGTAGTCGTGGTATTTACTTTACTCAAGATTGGTGTTCAATGCCAGGTGTTATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Chlorogonium_elongatum__AB206329__SkCl_2_ ---------------------------------------------------------------------GCTGGCTTCAAAGCAGGTGTAAAAGATTACCGTTTAACTTATTACACTCCAGATTACGTTGTAAGAGATACTGATGTATTAGCTGCATTCCGTATGACTCCTCAACCAGGTGTTCCACCTGAAGAGTGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACAGACGGTTTAACTAGCTTAGACCGTTACAAAGGTCGTTGTTACGACATCGAACCAGTTCCAGGTGAAGACAACCAATACATCGCATACGTAGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTTACTAACATGTTCACTTCAATCGTAGGTAACGTATTCGGTTTCAAAGCTTTACGTGCTTTACGTCTTGAAGACCTTCGTATCCCTCCAGCTTATGTTAAAACATTCTCTGGTCCTCCACACGGTATTCAGGTTGAACGTGACAAATTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCTAAGTTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGACTTCACAAAAGATGACGAAAACGTAACTTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTACAAATCACAAGCTGAAACTGGTGAAGTAAAAGGTCACTACTTAAACGTTACTGCTGGTACAGCAGAAGAAATGCTTAAACGTGCACAATGTGCTAAAGATTTAGGTGTACCTATTATTATGCACGACTACTTAACTGGTGGTTTCACTTCTAACACTTCATTAGCATTATTCTGTCGTGACAACGGTTTATTATTACACATCCACCGTGCTATGCACGCTGTAATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTATTAGCTAAAGCTTTACGTATGTCTGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACTTAATGCGTGATGACTACGTAGAAAAAGACCGTAGCCGTGGTATTTACTTTACTCAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Chloromonas_serbinowi_AJ001879 ---------------------------------------------------------------------GCAGGTTTTAAAGCTGGTGTTAAAGATTATCGTTTAACATATTATACTCCTGATTACGTTGTAAAAGAAACAGATATTCTTGCTGCATTCCGTATGACTCCACAAGCTGGTGTTCCTATTGAAGAAGCTGGTGCTGCTGTTGCTGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACAGACGGTTTAACTAGTCTTGATCGTTATAAAGGTCGTTGCTATGACATCGAACCAGTAGCAGGTGAAGAAAATCAATATATCGCATATGTTGCATACCCTATCGACTTATTTGAAGAAGGTTCTGTTACTAACTTATTTACATCAATTGTAGGTAACGTATTTGGTTTCAAAGCTCTTCGTGCTCTTCGTCTTGAAGATTTACGTATTGCTCCAGCATACTGTAAAACATTCCAAGGACCTCCACACGGTATTCAAGTAGAACGTGATAAATTAAACAAATATGGTCGTGGTCTATTAGGTTGTACTATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTATGGACGTGCTGTTTACGAATGTTTACGTGGTGGATTAGATTTTACAAAAGATGATGAAAACGTAACTTCTCAATCATTCATGCGTTGGAGAGACCGTTTCATTTTCGTTGCTGAAGCTCTTTATAAATCTCAAGCAGAAACTGGTGAAATTAAAGGTCACTATTTAAATGTAACTGCTGGTACTTCAGAAGAAATGTTAAAACGTGCTGAAGTTGCTAAAGATTTAGGTGTACCTATCATTATGCATGACTACTTAACTGGTGGTTTCACTGCTAACACTTCATTATCACACTACTGTCGTGATAATGGTTTACTATTACACATCCACAGAGCTATGCACGCGGTAATTGACCGTCAAAGAAACCACGGTATGCACTTCCGTGTATTAGCTAAAGCTCTTCGTCTATCAGGTGGTGACCACCTTCACTCAGGTACTGTTGTTGGTAAACTTGAAGGTGAACGCGAAGTAACTTTAGGTTTCGTTGATTTAATGCGTGATGAATATATTGAAAAAGACCGTAGCCGTGGTATTTATTTCACACAAGATTGGTGTGGTTTACCAGGTGTTATGCCAGTTGCTTCTGGTGGTATTCACGTATGGCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Chloromonas_perforata ------------------ATGTTTCATTATAAATTAATAATGGTTCCACAAACTGAAACAAGAGCTGGTGCTGGGTTTAAAGCCGGTGTAAAAGATTACCGTTTAACTTACTACACTCCTGATTACGTTGTAAGAGATACTGATATTTTAGCTGCGTTCCGTATGACTCCTCAAGCAGGTGTTCCCCCTGAAGAGTGTGGTGCTGCGGTTGCTGCAGAATCAAGTACAGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGTTTAGACCGTTACAAAGGACGTTGTTACGACATCGAACCAGTGCCTGGTGAAGACAATCAATACATTGCATACGTTGCATACCCAATCGACTTATTTGAAGAAGGTTCTGTAACAAACATGTTCACTTCTATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCACTACGTCTTGAAGACTTACGTATTCCTCCAGCTTATGTTAAAACATTCTCAGGTCCTCCACACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCTGTTTATGAATGTTTACGTGGTGGTCTTGACTTTACTAAGGATGACGAAAACGTAAACTCTCAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTGCAGAAGCATGTTACAAAGCTCAAGCAGAAACTGGTGAAGTTAAAGGGCATTATTTAAACGCTACAGCTGGTACAGCTGAAGAAATGTTAAAAAGAGCTCAATGTGCTAAAGAGTTAGGTGTACCTATTATTATGCATGACTATTTAACTGGTGGTTTTACTGCTAACACTTCATTAGCTTTATACTGTCGTGACCATGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTTATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCATTACGTATGTCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATGATTACGTTGAAAAAGACCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCTATGCCAGGTGTAATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCACATGCCTGCTTTAGTTGAAATCTTCGGCGACGACGCATGCTTACAATTCGGTGGTGGTACATTAGGTCACCCTTGGGGTAACGCACCTGGTGCTGTTGCTAACCGTGTAGCTTTAGAGGCTTGTACTCAAGCTCGTAACGAAGGTCGTGACCTTGCTCGTGAGGGTGGTGACGTAATTCGTTCAGCTTGTAAATGGTCTCCTGAATTAGCTGCGGCTTGTGAAGTTTGGAAAGAGATCAAATTCGAATTTGATACTATTGACAAACTATAA Chloromonas_rosae ---------------------------------------ATGGTTCCTCAAACACAAACTAAGGTTGGTGCAGGTTTTAAAGCTGGTGTTAAAGATTATCGTTTAACATATTATACTCCTGATTACGTTGTAAAAGAAACAGACATTCTTGCTGCATTCCGTATGACTCCACAAGCTGGTGTTCCTATTGAAGAAGCTGGTGCCGCGGTAGCTGCTGAATCTTCAACAGGTACATGGACAACTGTATGGACTGATGGTTTAACTAGTCTTGACCGTTATAAAGGTCGTTGTTATGACATCGAACCAGTAGCAGGTGAAGACAATCAATATATCGCTTATGTTGCATACCCTATCGAATTATTTGAAGAAGGTTCTGTTACTAGTTTATTAACATCTATTGTAGGTAACGTTTTTGGTTTCAAAGCTCTTCGTGCTCTACGTCTTGAAGATTTACGTATTTCTCCAGCATATGCTAAAACATTCCAAGGACCTCCACACGGTATTCAAGTAGAACGTGACAAATTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACTATCAAACCAAAATTAGGTCTTTCTGCTAAAAACTACGGACGTGCTGTTTATGAATGTTTACGTGGTGGTCTTGACTTCACGAAAGATGATGAAAACGTAACTTCTCAATCGTTTATGCGTTGGAGAGACCGTTTTATTTTCGTTTCTGAAGCTCTTTATAAATCTCAAGCTGAAACTGGTGAAATTAAAGGTCACTATTTAAATGCTACTTCAGGAACATCTGAAGAAATGTTAAAACGTGCTGAAGTTGCTAAAAATTTAGGTGTACCTATTATTATGCATGACTATTTAACAGGTGGTTTAACTGCTAACACTTCATTAGCACACTACTGTCGTGATAATGGTTTATTATTACACATTCACAGAGCTATGCACGCGGTTATTGACCGTCAAAGAAATCATGGTATTCACTTCCGTGTTTTAGCTAAAGTTCTACGTCTATCAGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAACTTGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGATTTAATGCGTGATGAATACATCGAAAAAGACCGTAGCCGTGGTATTTATTTCACTCAAGATTGGTGTGGTTTAGGTGGTGTAATGCCAGTAGCTTCTGGTGGTATCCACGTATGGCATATGCCTGCTTTAGTAGAAATCTTTGGTGATGACGCTTGTCTTCAATTCGGTGGTGGAACGTTAGGTCATCCTTGGGGAAATGCTCCTGGTGCTGCAGCTAACCGTGTAGCTCTAGAAGCTTGTACACAAGCTCGTAACGAAGGACGTGATTTAGCTCGTGAAGGCGGAGATGTAATCCGTTCAGCTTGCAAATGGAGTCCTGAATTAGCTGCTGCTTGTGAAGTTTGGAAAGAAATCAAATTCGAATTTGATACTATTGATAAACTATAA Chlorosarcinopsis_arenicola_AB451192__UTEX_1697 ---------------------------------------------------------------------GCTGGCTTCAAAGCAGGTGTAAAAGACTACCGTTTAACATACTACACTCCAGACTACGTTGTAAAAGATACTGATATCTTAGCTGCATTCCGTATGACTCCACAACCAGGTGTTCCACCTGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCTTCTACTGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGCTTAGACCGTTACAAAGGTCGTTGTTACGATATCGAACCAGTTCCGGGCGAAGACAACCAGTACATCGCTTACGTTGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACTTATTTACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCACTACGTCTTGAAGACCTTCGTATTCCTCCAGCTTACGTTAAAACATTTGAAGGTCCTCCACACGGTATTCAAGTTGAACGTGACAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTATGAGTGTTTACGTGGTGGTTTAGACTTCACTAAGGACGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCCTATTCGTAGCTGAAGCTATTTACAAAGCACAAGCAGAAACTGGTGAGGTTAAAGGCCACTATTTAAACGCTACTGCTGGTACTGCTGAAGAAATGTTAAAACGTGCACAATGTGCTAAGGAATTAGGTGTACCTATTATTATGCATGACTACCTTACAGGTGGTTTCACTGCTAACACTTCTTTATCTCACTACTGTCGTGACCACGGTCTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCTTTACGTATGTCTGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACTTAATGCGTGACGACTACATCGAAAAAGATCGTAGCCGTGGTGTTTACTTCACTCAAGACTGGTGTTCAATGTCAGGTGTTATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Chlorosarcinopsis_sp._A_KF_2011_strain_BCP_EM1VF1_gb|HQ246341.1|' ----------------------------------------------------------------------------------------------------GTTTAACATACTACACTCCAGACTACGTTGTAAAAGATACTGATATCTTAGCTGCATTCCGTATGACTCCACAACCAGGTGTACCACCTGAAGAGTGTGGTGCTGCTGTAGCTGCTGAGTCATCAACAGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGCTTAGACCGTTACAAAGGTCGTTGTTACGATATCGAACCAGTTCCAGGCGAGGACAACCAGTACATCGCTTACGTTGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACTTATTTACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCACTACGTCTTGAAGACCTTCGTATTCCTCCAGCTTACGTTAAAACATTTGAAGGTCCTCCACACGGTATTCAAGTTGAACGTGACAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTATGAATGTTTACGTGGTGGTTTAGACTTCACTAAGGACGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCCTATTCGTAGCTGAAGCTATTTACAAAGCACAAGCAGAAACTGGTGAGGTTAAAGGTCACTATTTAAACGCTACTGCTGGTACTGCTGAAGAAATGTTAAAACGTGCACAATGTGCTAAGGAATTAGGTGTGCCGATTATTATGCACGACTACTTAACAGGTGGTTTCACTGCTAACACTTCTTTATCTCACTACTGTCGTGACCACGGTCTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCTTTACGTATGTCTGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACTTAATGCGTGACGACTACATCGAAAAAGACCGTAGCCGTGGTGTTTACTTCACTCAAGACTGGTGTTCAATGTCAGGTGTTATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTTGAAATTTTCGGCGATGACGCTTGTTTACAATTCGGTGGTGGTACTCTAGGCCACCCATGGGGTAACGCACCTGGTGCTGTTGCTAACCGTGTTGCTTTAGAAGCTTGTACTCAAGCTCGTAACGAAGGTCGTGACCTTGCTCG---------------------------------------------------------------------------------------------------------------- Chlorosarcinopsis_eremi ---------------------------------------ATGGTTCCACAAACTGAAACGAGAGCAGGTGCTGGCTTCAAAGCAGGTGTAAAAGACTACCGTTTAACATACTACACTCCAGACTACGTTGTAAAAGATACTGATATCTTAGCTGCATTCCGTATGACTCCACAACCAGGTGTTCCACCTGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCTTCTACTGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGCTTAGACCGTTACAAAGGTCGTTGTTACGATATCGAACCAGTTCCGGGCGAAGACAACCAGTACATCGCTTACGTTGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACTTATTTACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCACTACGTCTTGAAGACCTTCGTATTCCTCCAGCTTACGTTAAAACATTTGAAGGTCCTCCACACGGTATTCAAGTTGAACGTGACAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTATGAGTGTTTACGTGGTGGTTTAGACTTTACTAAGGACGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCCTATTCGTAGCTGAAGCTATTTACAAAGCACAAGCGGAAACTGGTGAGGTTAAAGGCCACTATTTAAACGCTACTGCTGGTACTGCTGAAGAAATGTTAAAACGTGCACAATGTGCTAAGGAATTAGGTGTACCTATTATTATGCATGACTACCTTACGGGTGGTTTCACTGCTAACACTTCTTTATCTCACTACTGTCGTGACCACGGTCTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCTTTACGTATGTCTGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACTTAATGCGTGACGACTACATCGAAAAAGATCGTAGCCGTGGTGTTTACTTCACTCAAGACTGGTGTTCAATGTCAGGTGTTATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTTGAAATTTTCGGCGATGACGCTTGTTTACAATTCGGTGGTGGTACTCTAGGCCACCCATGGGGTAACGCACCTGGTGCTGTTGCTAACCGTGTTGCTTTAGAAGCTTGTACTCAAGCTCGTAACGAAGGTCGTGACCTTGCTCGTGAGGGTGGTGACGTAATTCGTTCTGCTTGTAAGTGGTCTCCAGAATTAGCAGCTGCTTGTGAAGTATGGAAAGAAATTAAGTTTGAATTCGATACAATCGACAAACTATAA Dunaliella_primolecta__AB127992__TS_3_ ---------------------------------------------------ACAGAAACGAAAACAGGTGCTGGGTTTAAAGCGGGTGTAAAAGATTACCGTTTAACATACTACACTCCAGACTACGTAGTTAGCGAAACTGATATTTTAGCAGCTTTCCGTATGACACCTCAACCAGGTGTTCCTCCAGAAGAGTGTGGTGCAGCAGTTGCTGCTGAATCATCAACTGGTACATGGACTACTGTATGGACTGATGGTCTTACAAGTTTAGACAAATACAAAGGTCGTTGTTATGACCTTGAACCAGTACCAGGTGAAGAAAATCAATATATCGCTTATGTAGCGTACCCAATCGACTTATTTGAAGAAGGTTCAGTAACAAACTTATTCACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCATTACGTCTTGAAGATCTTCGTATTTCACCAGCTTATGTTAAAACATTCGTTGGACCACCTCATGGTATTCAAGTTGAGCGTGACAAATTAAACAAATACGGTCGTGGTTTATTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTACGGACGTGCTGTTTACGAATGTTTACGTGGTGGATTAGACTTTACGAAGGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTACAAATCACAAGCAGAAACTGGTGAAATTAAAGGTCACTACTTAAACGCTACAGCAGGTACTGCTGAAGGAATGCTTCAACGTGCACAATGTGCTAAAGAGTTAGGTGTACCTATTATTATGCATGACTACTTAACAGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACACATTCACCGTGCGATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAACTTTACGTATGTCAGGTGGTGACCACCTTCACTCAGGTACTGTAGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGATTTAATGCGTGATAACTTCGTAGAAAAAGATCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTTGAAATCTTCGGTGATGACGCATGTTTACAATTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCTCCAGGTGCTGTAGCTAACCGTGTTGCATTAGAAGCTTGTACACAAGCTCGTAACGAAGGACGTGACCTTGCTCGTGAAGGTGGTAACGTAATCCGTTCAGCTTGTAAATGGTCT------------------------------------------------------------------------ Dunaliella_viridis_UTEX_1983_AJ001877 ---------------------------------------------------------------------ACTGGGTTTAAAGCTGGTGTAAAAGACTACCGTTTAACATATTACACTCCAGACTACGTAGTTAGCGAAACTGATATTTTAGCAGCTTTCCGTATGACTCCACAACCTGGTGTACCACCAGAAGAGTGTGGTGCAGCCGTAGCAGCTGAGTCATCAACAGGTACATGGACAACAGTATGGACTGACGGTTTAACAAGTTTAGACCGTTACAAAGGTCGTTGTTATGATTTAGAACCTGTGCCGGGGGAGGAAAATCAGTACATCGCTTACGTAGCATACCCCATTGACTTATTCGAAGAAGGTTCAGTAACAAACTTATTCACTTCAATTGTAGGTAACGTATTCGGTTTCAAAGCGTTACGTGCATTACGTTTAGAAGACCTTCGTATTTCACCAGCTTACGTTAAAACATTCGTTGGACCACCTCACGGTATCCAAGTTGAACGTGACAAATTAAACAAATATGGTCGTGGTTTATTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGACTTCACTAAGGACGACGAGAACGTAAACTCTCAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTACAAAGCACAAACAGAAACAGGTGAAATTAAAGGTCACTACTTAAACTGTACAGCAGGTACGTCTGAAGGTATGCTTCAACGTGCACAATGTGCTAAAGAATTAGGTGTACCTATTGTAATGCATGACTACCTAACAGGTGGTTTCACAGCAAACACTTCATTAGCACATTTCTGTCGTGACCACGGTCTTTTATTACACATTCACCGTGCGATGCACGCTGTAATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTTTTAGCTAAAACTTTACGTATGTCAGGTGGTGACCACCTTCACTCAGGTACTGTAGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGACTTAATGCGTGATAACTTCGTAGAAAAAGACCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Dunaliella_salina ---------------------------------------ATGGTTCCACAAACTGAAACGAAAACAGGTGCTGGGTTTAAAGCGGGTGTAAAAGATTACCGTTTAACATACTACACTCCAGACTACGTAGTTAGCGAAACTGATATTTTAGCAGCTTTCCGTATGACACCTCAACCAGGTGTTCCTCCAGAAGAGTGTGGTGCAGCGGTTGCTGCTGAATCATCAACTGGTACATGGACTACTGTATGGACTGATGGTCTTACAAGTTTAGACAAATACAAAGGTCGTTGTTACGACCTTGAACCAGTGCCCGGTGAAGAAAATCAATATATCGCATATGTAGCGTACCCAATCGACCTTTTTGAGGAAGGTTCAGTAACAAACTTATTCACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCATTACGTCTTGAAGATCTTCGTATTTCACCAGCTTATGTTAAAACATTCGTTGGACCACCTCATGGTATTCAAGTTGAGCGTGACAAATTAAACAAATATGGTCGTGGTTTATTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTACGGACGTGCTGTTTACGAATGTTTACGTGGTGGATTAGACTTTACCAAAGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTACAAAGCACAAGCAGAAACTGGTGAAATTAAAGGTCACTACTTAAACGCTACAGCAGGTACTGCTGAAGGAATGCTTCAACGTGCACAATGTGCTAAAGAGTTAGGTGTACCTATTATTATGCATGACTACTTAACAGGTGGTTTTACTGCTAACACTTCATTAGCTCATTACTGTCGTGATCATGGTTTATTATTACACATTCACCGTGCGATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAACTTTACGTATGTCAGGTGGTGACCACCTTCACTCAGGTACTGTAGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGATTTAATGCGTGATAACTTCGTAGAAAAAGATCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTTGAAATCTTCGGTGATGACGCATGTTTACAATTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCACCAGGTGCTGTTGCTAACCGTGTTGCATTAGAGGCTTGTACACAAGCTCGTAACGAAGGACGTGACCTTGCTCGTGAAGGTGGTAACGTAATCCGTTCAGCTTGTAAATGGTCTCCTGAATTAGCAGCTGCTTGTGAAGTTTGGAAAGAAATTAAATTCGAATTCGATACAGTTGATAAATTATAA Dysmorphococcus_globosus__AJ001885_SAG20_1_ ---------------------------------------------------------------------GCTGGATTTAAAGCAGGTGTAAAAGATTACCGTCTTACTTATTATACTCCAGACTATGTTGTAAAAGATACAGATATTTTAGCAGCATTCCGTATGACACCTCAGCCAGGTGTTCCGCCAGAAGAGTGTGGTGCTGCTGTTGCTGCTGAATCTTCAACAGGTACATGGACTACAGTATGGACTGATGGTCTAACAAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATTGAGCCGGTTCCTGGCGAAGACAATCAATATATTGCTTATGTTGCTTATCCAATTGACTTATTTGAAGAAGGTTCTGTTACAAACATGTTTACTTCAATTGTAGGTAACGTATTTGGGTTCAAAGCTTTACGTGCCTTACGTCTTGAAGATTTACGTATTCCTCCAGCTTATGTAAAAACATTCTCTGGACCTCCACATGGTATTCAAGTAGAACGTGACAAAATCAATAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCAAAATTAGGTTTATCAGCTAAAAACTATGGACGTGCAGTTTATGAATGTTTACGTGGTGGTTTAGATTTCACAAAAGATGATGAAAACGTAAACTCACAACCATTTATGCGTTGGAGAGACCGTTTCTTATTTGTTGCTGAAGCAATTTATAAAGCTCAAGCTGAAACTGGTGAAGTTAAAGGTCATTATTTAAATGCTACTGCAGGTACTGCAGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGAATTAGGTGTACCTATTATTATGCATGACTATTTAACAGGTGGTTTCACTGCTAACACTTCTTTAGCTATTTATTGTCGTGATCATGGTTTATTATTACACATTCACCGTGCAATGCACGCTGTTATTGACCGTCAAAGAAATCATGGTATTCACTTCCGTGTTCTTGCTAAAGCTTTACGTATGTCTGGTGGTGATCATTTACACTCTGGTACAGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTTGTTGACTTAATGCGTGATGATTATATTGAAAAAGATCGTAGTCGTGGTATTTACTTTACACAAGACTGGTGTTCTATGCCTGGTGTAATGCCTGTTGCTTCAGGTGGTATTCATGTTTGGCAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ 'Fusochloris_perforata_UTEX_2104_EF113438.1' -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GCCAGAAGAATGTGGTGCAGCAGTAGCGGCAGAATCTTCTACTGGTACTTGGACAACTGTATGGACAGATGGATTAACTAGTCTTGATCGTTATAAAGGTCGTTGCTATGATCTTGAACCGGTTCCAGGTGAAGATAATCAGTATATCGCATATGTTGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCAGTAACTAACTTATTTACTTCGATTGTAGGTAACGTTTTTGGTTTTAAAGCATTACGTGCACTACGTTTAGAAGATCTTCGTATTCCTCCGGCTTACGTTAAAACTTTTTCAGGACCTCCTCACGGTATTCAAGTAGAACGTGACAAATTAAACAAATATGGACGTTCCCTTTTAGGTTGTACTATTAAACCAAAATTAGGTCTTTCTGCTAAAAATTACGGTCGTGCAGTTTATGAATGTTTACGTGGTGGACTTGATTTTACCAAAGATGATGAGAATGTGAATTCACAACCATTTATGCGTTGGAGAGATCGTTTTTTATTCGTAGCTGAAGCAATTTACAAATCTCAAGCAGAAACAGGCGAAATTAAAGGACATTACTTAAACGCAACTGCTGGAACTTGCGAAGAAATGTTAAAACGTGCAGCATGTGCAAAAGACTTAGGTATGCCTATTATCATGCATGATTATTTAACTGGTGGGTTTACTGCAAACACTAGTTTATCTAATTACTGCCGTGATCATGGTCTTTTACTTCATATTCACCGTGCTATGCACGCTGTTATTGACCGTCAAAAAAACCATGGTATGCATTTCCGTGTTTTAGCAAAAGCTCTACGTATGTCTGGGGGAGATCATCTTCATTCTGGAACAGTTGTAGGAAAACTGGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGATTTAATGCGTGACGATTATATCGAAAAAGATCGTAGTCGTGGTGTTTATTTCACTCAAGATTGGGTTTCTCTTCCAGGAGTAATGCCTGTAGCATCTGGTGGTATTCATGTTTGGCATATGC-------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Gonium_pectorale ---------------------------------------ATGGTTCCACAAACAGAAACTAAAGCAGGTGCTGGGTTCAAAGCCGGTGTAAAAGACTATCGTTTAACATATTACACACCTGATTACGTAGTAAAAGATACTGATATTTTAGCTGCATTCCGTATGACTCCACAACCTGGTGTTCCACCTGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACATGGACAACTGTATGGACAGACGGTTTAACTAGTCTTGACCGTTATAAAGGTCGTTGTTATGACATCGAGCCAGTACCAGGCGAAGACAACCAATACATTGCTTATGTTGCTTACCCAATCGACTTATTTGAAGAAGGTTCAGTAACAAACATGTTCACTTCGATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCTCTACGTCTTGAAGACCTTCGTATTCCACCTGCTTATGTTAAAACATTCCAAGGTCCGCCACATGGTATTCAGGTTGAACGTGACAAATTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCTGTTTACGAGTGTTTACGTGGTGGTTTAGATTTCACTAAAGACGACGAAAACGTTAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCCTTTTTGTAGCTGAAGCTATTTACAAAGCACAAGCAGAAACAGGTGAGGTAAAAGGTCACTATTTAAACGCAACTGCTGGTACTTGTGAAGAAATGTTAAAACGTGGTCAATGTGCTAAAGAATTAGGTGTACCTATTATTATGCATGACTACTTAACTGGTGGTTTTACTGCTAATACTTCATTAGCTTCTTACTGTCGTGACAATGGTTTACTTCTTCACATCCACCGTGCGATGCACGCTGTTATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTACTTGCTAAAGCTTTACGTATGTCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACTTAATGCGTGACGACTATATTGAAAAAGATCGTAGCCGTGGTATTTACTTCACACAAGATTGGTGTTCAATGCCAGGTGTAATGCCAGTTGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCTCTTGTTGAAATTTTCGGTGATGACGCTTGTCTTCAATTCGGTGGTGGTACTTTAGGTCACCCATGGGGTAACGCTCCAGGTGCTGCAGCTAACCGTGTTGCTCTTGAAGCTTGTACACAAGCACGTAACGAAGGTCGTGACCTTGCTCGTGAAGGTGGCGATGTAATTCGTTCAGCTTGTAAATGGTCTCCAGAACTTGCGGCTGCATGTGAAGTTTGGAAAGAAATCAAATTTGAATTCGATACTATTGACAAACTTTAA 'Gungnir_kasakii_CCAP_12/8_AB010244' ---------------------------------------------------------------------GCTGGATTTAAAGCTGGTGTTAAAGACTATCGTTTAACTTATTATACACCAGACTACGTTGTAAGAGAAACTGATATTTTAGCTGCATTCCGTATGACTCCACAACCAGGTGTTCCACCTGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCATCAACTGGTACATGGACAACTGTATGGACTGACGGTTTAACTAGCTTAGATCGTTACAAAGGTCGTTGTTATGACATCGAACCAGTTCCAGGTGAAGACAACCAATACATCGCTTATATTGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACTTATTCACATCTATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCTCTACGTTTAGAAGATTTACGTATTCCTCCAGCTTACGTTAAAACTTTTGAAGGTCCTCCTCACGGTATTCAAGTTGAACGTGACCGTTTAAACAAATATGGTCGTGGTTTATTAGGTTGTACAATTAAACCTAAATTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGACTTCACAAAAGACGACGAAAACGTTAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTGCTGAAGCTATCTACAAATCACAAGCTGAAACTGGCGAAGTTAAAGGCCACTATTTAAACGCTACAGCTGCAACATCTGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGATTTAGGTGTACCTATTATTATGCATGACTACTTAACTGGTGGTTTCACTGCTAACACTTCTTTATCTAAATATTGCCGTAACGAAGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAACGTAACCACGGTATCCACTTCCGCGTATTAGCTAAAGCTTTACGTTTATCAGGTGGTGACCACTTACACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACATTAGGTTTCGTAGACTTAATGCGTGACGATTACGTTGAAAAAGACCGTAGCCGTGGTATTTATTTCACTCAAGATTGGTGTTCAATGCCAGGTGTAATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Gungnir_neglectum_IkCl_701_AB360756 -----------------------------------------------------------GAGAGCAAGTGCTGGATTTAAAGCGGGTGTAAAAGATTATCGTTTAACTTATTATACTCCAGACTACGTAGTAAGAGAAACTGATATTTTAGCGGCATTCCGTATGACTCCACAACCAGGTGTTCCACCTGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCTTCAACTGGTACATGGACAACTGTATGGACAGACGGTTTAACAAGTTTAGATCGTTATAAAGGTCGTTGTTATGACATCGAGCCTGTTCCTGGTGAAGACAACCAGTACATTGCTTATGTAGCTTACCCAATCGATTTATTCGAAGAAGGTTCAGTTACTAACATGTTTACTTCTATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCTCTACGTTTAGAAGATCTTCGTATTCCTCCAGCTTACGTTAAAACTTTTGAAGGTCCTCCACATGGTATTCAAGTTGAACGTGACAAAATTAACAAATATGGTCGTGGTTTATTAGGTTGTACAATTAAACCTAAATTAGGTTTATCTGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTCTTGACTTTACAAAAGATGACGAAAACGTTACTTCACAACCGTTTATGCGTTGGAGAGACCGTTTCTTATTCGTAGCTGAAGCTATTTATAAATCACAATCTGAAACTGGTGAAGTAAAAGGTCACTATTTAAACGCTACTGCAGGTACTGCAGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGAATTAGGTGTACCTATTATTATGCACGACTACTTAACTGGTGGTTTTACTGCTAACACTACATTATCTAAATTCTGTCGTGACCACGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCATTACGTATGTCAGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACATTAGGTTTCGTTGACTTAATGCGTGACGACTACGTTGAAAAAGACCGTAGCCGTGGTATTTATTTCACTCAAGACTGGTGTTCAATGCCGGGTGTAATGCCAGTAGCTTCTGGTGGTATTCACGTTTGGCACATGCCTGCTTTAGTTGAAATCTTCGGTGATGACGCTTGTTTACAGTTCGGGGGTGGTACCCTTGGTCACCCATGGGGTAACGCTCCAGGTGCTGTTGCAAACCGTGTTGCTTTAGAAGCTTGTACTCAAGCTCGTAACGAAGGTCGCGATNTTAGCTCGTGAAGGNCGGAGATGTTATC------------------------------------------------------------------------------------------- 'Heterochlamydomonas_inaequalis_SAG_4.75_EF113448' -----------------------------------------GTTCCAC-AAACAGAAACTAAAGCAGGTGCTGGTTTTAAAGCAGGTGTTAAAGATTATCGTTTAACTTATTACACTCCTGATTACGTTGTAAAAGAAACAGACATTCTTGCAGCATTCCGTATGACTCCTCAACCAGGAGTTCCTCCAGAAGAGTGTGGTGCAGCTGTTGCTGCTGAATCTTCAACTGGTACTTGGACAACTGTATGGACTGACGGTTTAACTAGCCTTGACCGTTACAAAGGGCGTTGTTACGATCTTGAACCAGTAGCTGGTGAAGAAAACCAATACATTGCTTATGTTGCATACCCAATCGACTTATTTGAAGAAGGTTCTGTTACTAACCTATTCACTTCTATCGTAGGAAACGTATTTGGTTTCAAAGCTCTTCGTGCACTACGTTTAGAAGACCTTCGTATTCCTCCTGCTTACGTTAAAACATTCCAAGGACCTCCACACGGTATCCAAGTTGAACGTGACAAACTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGACGTGCTGTATACGAATGTTTACGTGGTGGTTTAGACTTCACTAAAGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCCTTTTCGTAGCTGAAGCTATTTACAAATCACAAGCTGAAACTGGTGAAGTAAAAGGTCACTACTTAAACGCTACTGCAGGTAACTGTGATGAAATGATCAAACGTGCTCAATGTGCTAAAGATTTAGGTATGCCTATTATTATGCATGACTACTTAACAGGTGGTTTCACAGCTAACACATCATTAGCTCACTACTGTCGTGACCATGGTCTATTATTACACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATCCACTTCCGTGTATTAGCTAAAGCTCTTCGTCTATCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACATTAGGTTTCGTAGACCTAATGCGTGATGACTACATCGAAAAAGACCGTAGCCGTGGTGTTTACTTCACTCAAGACTGGTGTTCTATGTCAGGTGTTATGCCAGTAGCTTCTGGTGGTATTCACGTATGGCACATGCCAGCTCTAGTTGAAATCTTCGGTGATGACGCTTGTCTTCAGTTCGGTGGTGGTACACTTGGTCACCCTTGGGGTAACGCTCCAGGTGCTGTTGCTAACC----------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Microthamnion_kuetzingianum_CCAP_450/1b_EF589152.1' ---------------------------------------------------------------------GCTGGCTTTAAAGCAGGTGTAAAAGATTACCGTTTAACGTACTATACACCTGATTACCAAGTAAAAGAGACTGATATTCTTGCTGCTTTTCGTATGACTCCACAACCTGGTGTTCCTCCGGAAGAATGTGCTGCAGCAGTTGCTGCTGAATCATCTACAGGTACTTGGACTACTGTATGGACTGATGGATTAACTAGTCTTGACCGTTACAAAGGTCGTTGCTATGATCTAGAACCAGTACCAGGCGAAGACAACCAGTATATTGCTTATGTTGCTTACCCTTTAGATCTTTTTGAAGAAGGTTCTGTAACTAACTTATTTACTTCTATTGTAGGAAACGTTTTTGGTTTTAAAGCATTACGTGCACTACGTCTAGAAGATCTTCGTATTCCTCCGGCTTACGTTAAAACTTTCCAAGGTCCTCCTCATGGTATTCAAGTAGAACGCGACAAATTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCTAAACTAGGTCTTTCTGCTAAAAACTATGGACGTGCGGTTTATGAGTGTTTACGTGGTGGTCTTGACTTTACGAAAGATGATGAGAACGTAAACTCACAACCATTTATGCGTTGGAGAGATCGTTTCCTATTCGTAGCAGAAGCTATTTACAAATCTCAAGCAGAAACTGGAGAAATTAAAGGTCATTACTTAAATGCTACTGCAGGAACTTGCGAAGAAATGCTGAAACGTGCAGAATGTGCTAAAGATTTAGCTATGCCTATTATTATGCACGATTACTTAACTGGTGGTTTCACTGCAAATACTACTTTAGCAAAGTACTCTCGTGATAATGGTCTGTTACTACACATTCACCGAGCTATGCACGCGGTTATTGACCGTCAAAAAAATCATGGTATGCACTTCCGTGTTTTAGCAAAAGCTCTACGTCTATCTGGTGGGGATCATCTTCATTCAGGAACTGTAGTAGGAAAACTTGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTTGATTTAATGCGTGATGATTACATCGAAAAAGATCGTAGTCGTGGTGTTTACTTTACTCAAGATTGGGTATCTCTTCCAGGTACAATGCCAGTAGCTTCAGGTGGTATTCACGTATGGCATATG--------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Oophila_sp._CT_2013c_469' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTCCAGCTGAAGAATGTGGTGCAGCAGTTGCAGCTGAATCATCAACTGGTACTTGGACAACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGATATCGAGCCTGTTCCAGGAGAAGATAACCAATTTATTGCATATGTTGCATATCCAATYGATTTATTTGAAGAAGGTTCTGTAACAAACCTATTTACTTCAATTGTTGGTAATGTATTTGGTTTCAAAGCTTTACGTGCTCTTCGTCCACMMGCSCTTCGTATTCCTCCAGCATATGTTAAAACATTCTCAGGACCTCCTCATGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGGTGTACAATTAAGCCTAAATTAGGTCTTTCAGCTAAAAACTATGGTCGTGCTGTTTATGAATGTCTACGTGGTGGTTTAGACTTTACTAAAGATGATGAAAACGTTAACTCTCAACCATTTATGCGTTGGCGTGACCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCGGAAACTGGTGAAGTAAAAGGACACTATTTAAATGCTACAGCTGGAACATCGGAAGAAATGATCAAACGTGCTGTTTGTGCTAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Oophila_sp._CT2013b_310' ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CCAGGTGTTCCAGCTGAAGAATGTGGTGCAGCAGTTGCAGCTGAATCATCAACTGGTACTTGGACAACAGTTTGGACTGATGGTTTAACTAGTTTAGATCGTTATAAAGGTCGTTGTTATGATATCGAGCCTGTTCCAGGAGAAGATAACCAATTTATTGCATATGTTGCATATCCAATYGATTTATTTGAAGAAGGTTCTGTAACAAACCTATTTACTTCAATTGTTGGTAATGTATTTGGTTTCAAAGCCSSSCSTGCTCTTCGTTTAGAAGATCTTCGTATTCCTCCAGCATATGTTAAAACATTCTCAGGACCTCCTCATGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGGTGTACAATTAAGCCTAAATTAGGTCTTTCAGCTAAAAACTATGGTCGTGCTGTTTATGAATGTCTACGTGGTGGTTTAGACTTTACTAAAGATGATGAAAACGTTAACTCTCAACCATTTATGCGTTGGCGTGACCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCGGAAACTGGTGAAGTAAAAGGACACTATTTAAATGCTACAGCTGGAACATCGGAAGAAATGACCAAACGTGCTGTTTGTGCTAAAGAATTTGGAGTTCCGATTATTATGCATGACTATATTACTGGAGGTTTTACMGCTAACACTTCATTAGCTAATTACTGTCGTGATCATGGTTTATTATTACACATTCACCGTGCAATGCATGCAGTTATTGATCGTCAAAGAAATCATGGTATCCACTTCCGYGTTTTAGCGAAAGCTCTACGTTTATCAGGTGGTGATCATTTACACTCAGGTACTGTGGTAGGTAAATTAGAAGGTGAACGTGAAGTAACATTAGGGTTTGTTGACTTAATGCGTGATAATTATATTGAAAAAGATCGTAGCCGTGGTATTTATTTCACACAAGATTGGTGTTCAATGTCAGGTGTTATGCCAGTTGCTTCTGGTGGTATTCATGTTTGGCATATGCCAGCATTAGTTGAAATCTTTGGTGATGATGCATGTCTTCAATTTGGTGGTGGTACTTTAGGTCACCCATGGGGTAATGCACCAGGTGCAGTTGCTAACCGTGTTGCTCTTGAGGCTTGTACT------------------------------------------------------------------------------------------------------------------------------------------------ 'Pascherina_tetrasm_AB542929.1' -----------------------------------------------------------GCGCGCAGGTGCGGGATTTAAAGCTGGTGTAAAAGACTACCGTCTTACTTATTACACTCCTGATTATGTAGTAAAAGATACTGATATTCTTGCTGCATTCCGTATGACTCCACAACCAGGTGTTCCACCTGAAGAATGTGGTGCAGCTGTAGCAGCTGAATCTTCAACTGGTACTTGGACAACAGTATGGACTGATGGTCTTACAAGCTTAGACCGTTACAAAGGTCGTTGTTATGATCTTGAACCAGTTCCTGGTGAAGATAACCAATACATCGCTTACGTTGCATACCCTCTAGATCTATTTGAAGAAGGTTCTGTTACAAACATGTTCACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCTCTTCGTCTAGAAGATCTTCGTATCCCTGTTGCTTATGCTAAAACTTTCTATGGTCCTCCACACGGTATCCAAGTAGAACGTGACAAACTAAACAAATATGGTCGTGGTCTATTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCTGTTTACGAATGTTTACGTGGTGGTTTAGACTTCACAAAAGATGATGAAAACGTTAACTCTCAACCATTCATGCGTTGGCGCGACCGTTTCCTTTTCGTTGCTGAAGCTATCTACAAATCTCAAGCTGAAACTGGCGAAGTTAAAGGGCACTACTTAAACGCAACAGCTGGTACAGCTGAAGAAATGATCAAACGTGCAGTATGTGCTAAAGAATTAGCTATGCCTATCGTTATGCACGACTACCTAACAGGTGGTTTCACTGCTAACACTTCATTAGCTAACTACTGTCGTGATAATGGTCTTCTTCTTCACATTCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCATGGTATTCACTTCCGTGTTCTTGCTAAAGCCCTACGTATGTCTGGTGGTGACCACTTACACTCTGGTACCGTTGTTGGTAAATTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACCTTATGCGTGATGATTACGTAGAAAAAGATCGTAGCCGTGGTATTTACTTCACTCAAGATTGGGCTTCATTACCAGGTGTAATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCACATGCCTGCTTTAGTTGAAATCTTTGGTGATGACGCTTGTTTACAATTTGGTGGCGGAACACTAGGTCACCCTTGGGGTAACGCTCCAGGTGCTGTAGCTAACCGTGTTGCTCTTGAAGCTTGTACTCAAGCTCGTAACGAAGGTCGTGACCTTGCTCGTGAAGGTGGTGACGTTATTCGTTCAGCTTGTCGTTGGTCTCCAGAATTAGCTGCTGCTTGTGAA------------------------------------------------ Paulschulzia_pseudovolvox_D86825 ---------------------------------------------------------------------GCTGGGTTCAAAGCCGGTGTAAAAGACTATCGTTTAACTTATTACACGCCTGATTACGTTGTAAAAGATACTGATATCCTAGCTGCATTCCGTATGACTCCACAACCCGGTGTTCCACCTGAAGAATGTGGTGCTGCAGTAGCTGCTGAATCATCAACAGGTACTTGGACAACAGTATGGACTGACGGTCTTACAAGCTTAGACCGTTACAAAGGTCGTTGTTATGACATTGAGCCAGTTCCAGGTGAAGAAAACCAGTACATTGCTTATGTAGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACCTGTTCACTTCAATCGTAGGTAACGTATTTGGTTTCAAAGCATTACGTGCTCTACGTCTTGAAGATCTTCGTATTTCTGCAGCTTACGTTAAAACGTTCCAAGGTCCACCTCACGGTATCCAGGTAGAACGTGACAAACTAAACAAATATGGTCGTGGTCTTCTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCTGTTTATGAGTGTTTACGTGGTGGTCTAGATTTCACAAAAGATGACGAAAACGTTAACTCACAACCTTTCATGCGTTGGAGAGACCGTTTCCTTTTCGTAGCTGAAGCTATCTATAAATCACAAGCTGAAACAGGTGAAGTAAAAGGTCACTACTTAAACGCTACAGCAGGTAACTGTGACGAAATGATGAAACGTGCGGTATGTGCTAAAGATTTCGGTGTACCAATCGTAATGCATGACTACCTTACAGGTGGTTTCACTGCAAACACAACTTTAGCTTCTTATTGCCGTGACAACGGTCTTCTTCTTCACATCCACCGTGCTATGCACGCGGTTATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTTCTAGCTAAAACACTTCGTATGTCAGGTGGTGACCACCTTCACTCAGGTACTGTTGTTGGTAAACTAGAAGGTGAGCGTGAAGTAACTCTAGGTTTCGTAGACTTAATGCGTGACGACTACGTTGAAAAAGACCGTAGCCGTGGTATTTATTTCACTCAAGACTGGTGTTCAATGCCAGGTGTTATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCACA----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Pleurastrum_insigne_SAG_30.93_EF113464.1' ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GGTGTTCCACCTGAGGAATGTGGCGCTGCGGTTGCCGCAGAATCTTCAACGGGTACTTGGACAACTGTATGGACTGATGGTTTAACTAGTTTAGACCGTTACAAAGGTCGTTGTTACGATATCGAACCTGTACCAGGTGAAGACAACCAATATATCGCATATGTAGCATACCCAATCGATTTATTTGAAGAAGGTTCAGTAACAAACATGTTCACTTCTATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCACTACGTCTTGAAGATTTACGTATTCCTCCAGCTTATGTTAAAACATTCTCAGGTCCTCCACACGGTATTCAAGTAGAACGTGATAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCTAAATTAGGTTTATCAGCTAAAAACTACGGTCGTGCTGTTTATGAATGTTTACGTGGTGGGCTTGACTTTACTAAAGATGATGAAAACGTAAACTCTCAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTGCAGAAGCATGTTACAAAGCTCAAGCAGAAACTGGTGAGGTTAAAGGGCATTATTTAAATGCTACAGCTGGGACTGCTGAAGAAATGTTAAAAAGAGCTCAATGTGCTAAAGAGCTTGGGGTACCAATTATTATGCATGACTATTTAACTGGTGGTTTTACAGCTAACACTTCATTAGCTTTATACTGTCGTGACCATGGTTTATTATTACACATTCACCGTGCTATGCACGCTGTTATTGACCGTCAAAGAAACCACGGTATTCACTTCCGTGTTTTAGCTAAAGCATTACGTATGTCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTAGGTAAATTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTTGACTTAATGCGTGATGATTACGTTGAAAAAGACCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCTATGCCAGGTGTAATGCCAGTTGCTTCTGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Pseudotetracystis_UTEX1927 ----------------------------------------------------------------------------------------------------------------------CAGAGTACGTTGTAAAAGATACTGATATCTTAGCTGCATTCCGTATGACTCCTCAACCAGGTGTTCCACCAGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCATCAACTGGTACTTGGACAACTGTATGGACTGACGGTTTAACTAGCTTAGACCGTTACAAAGGTCGTTGTTACGACATCGAACCAGTACCGGGTGAGGACAACCAGTACATCGCTTACGTAGCTTACCCAATCGACTTATTCGAAGAAGGTTCAGTAACTAACATGTTCACTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCTTTACGTGCACTACGTCTTGAAGACTTACGTATTCCTCCAGCTTACGTTAAAACTTTCACTGGTCCACCACACGGTATCCAAGTAGAACGTGACAAATTAAACAAATACGGTCGTGGCCTTTTAGGTTGTACAATCAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCAGTTTACGAATGTTTACGTGGTGGTTTAGACTTCACAAAAGATGACGAAAACGTAAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCTTATTCGTTTCTGAAGCTATCTACAAAGCTCAAGCAGAAACTGGTGAAGTAAAAGGTCACTACTTAAACGCAACTGCTGGTACTTCTGAAGAAATGTTAAAACGTGCACAATGTGCTAAAGAATTCGGTGTGCCGATTATTATGCACGACTACCTAACAGGTGGTTTTACTTCTAACACTTCATTAGCAAACTACTGTCGTGACAACGGTTTATTATTACACATCCACCGTGCTATGCACGCTGTAATTGACCGTCAAAGAAACCACGGTATCCACTTCCGTGTTTTAGCTAAAGCTTTACGTATGTCTGGTGGTGACCACTTACACTCAGGTACTGTAGTAGGTAAGTTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGACTTAATGCGTGATGACTACATTGAAAAAGACCGTAGCCGTGGTATTTACTTCACTCAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCACATGCCAGCTTTAGTTGAAATCTTCGGTGATGACGCTTGTTTACAGTTCGGTGGTGGTACTTTAGGTCACCCTTGGGGTAACGCACCTGGTGCTGTTGCTAACCGTGTTGCTTTAGAAGCTTGTACACAAGCTCGTAACGAAGGTCGTGACTTAGCTCGCGAAGGTGGTGACGTT------------------------------------------------------------------------------------------------ Tetracystis_aeria__EF113476__UTEX_1453_ ---------------------------------------------------------ACAAAAGCCGGTGCTGGTTTTAAAGCAGGTGTAAAAGATTACCGTCTTACTTATTATACACCAGATTACGTTGTTAAAGAAACTGATATTTTAGCTGCTTTCCGTATGACTCCTCAACCAGGTGTTCCAGCTGAAGAATGTGGTGCTGCAGTAGCTGCTGAATCATCAACTGGTACTTGGACAACAGTATGGACTGATGGTTTAACAAGCTTAGACCGTTATAAAGGACGTTGTTATGACATCGAACCTGTTCCAGGTGAAGACAATCAGTACATTGCTTACGTTGCTTACCCTATCGATTTATTCGAAGAAGGTTCAGTAACTAACCTATTTACTTCAATTGTTGGTAACGTATTTGGTTTTAAAGCTTTACGTGCTCTACGTTTAGAAGATTTACGTATTCCTCCTGCTTATGTTAAAACTTTCTCTGGGCCTCCTCACGGTATCCAAGTAGAACGTGACAAAATTAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCAAAATTAGGTCTTTCGGCTAAAAACTATGGTCGTGCAGTTTACGAATGTTTACGTGGTGGGCTAGATTTTACTAAAGATGATGAAAACGTAAACTCTCAACCTTTTATGCGTTGGCGTGATCGTTTCCTTTTCTGTGCTGAAGCTATTTATAAAGCTCAAGCTGAAACTGGTGAAGTAAAAGGTCACTATTTAAACGCTACAGCTGCTACTTCTGAAGAAATGATCAAACGTGCTGTTTGTGCTAAAGAATTTGGTGTACCTATTATTATGCATGACTACTTAACTGGTGGTTTCACTTCTAACACTTCTTTATCTAACTATTGTCGTGATCATGGTTTATTACTTCATATTCACCGTGCTATGCATGCTGTTATTGACCGTCAAAGAAACCATGGTATTCACTTCCTTGTTTTAGCTAAAGCTCTTCGTTTATCTGGTGGTGACCACCTTCACTCTGGTACTGTTGTTGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTTGTTGATTTAATGCGTGATAACTATGTTGAAAAAGATCGTAGCCGTGGTATTTACTTTACTCAAGATTGGTGTTCAATGGCAGGTGTTATGCCAGTAGCTTCTGGTGGTATTCACGTTTGGCATATGCCAGCTTTAGTTGAAATTTTCGGTGATGACGCTTGTCTTCAATTCGGTGGTGGTACTTTAGGACACCCTTGGGGTAACGCTCCTGGTGCTGTTGCTAACC----------------------------------------------------------------------------------------------------------------------------------------------------------------------- 'Tetraspora_sp.__EF113477__UTEX_LB_234_' -------------------------------------------------AAACAGAAACTAAAGCAGGTGCTGGGTTCAAAGCCGGTGTAAAAGACTATCGTTTAACTTATTACACACCTGATTACGTTGTAAAAGATACTGATATTTTAGCTGCATTCCGTATGACTCCACAACCTGGTGTACCACCAGAAGAGTGTGGTGCTGCTGTAGCTGCTGAATCATCAACAGGTACTTGGACAACAGTATGGACTGACGGTTTAACTAGTTTAGACCGTTACAAAGGTCGTTGCTATGACATTGAGCCAGTTCCGGGCGAAGAAAATCAGTACATTGCTTATGTAGCTTACCCAANCGACTTATTCGAAGAAGGTTCANTAACTAACCTGTTCNCTTCAATTGTAGGTAACGTATTTGGTTTCAAAGCGTTACGTGCTCTACGTCTTGAAGACCTTCGTATTTCTGCAGCTTACGTTAAAACGTTCCAAGGTCCACCTCACGGTATCCAAGTAGAACGTGACAAACTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATTAAACCTAAATTAGGTCTTTCAGCTAAAAACTACGGTCGTGCTGTTTATGAGTGTTTACGTGGTGGTCTAGATTTCACAAAAGATGACGAAAACGTTAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCCTTTTCGTAGCTGAAGCTATCTATAAAGCACAATCTGAAACAGGTGAAGTAAAAGGTCACTACTTAAACGCTACTGCAGGTAACTGTGATGAAATGATGAAACGTGCAGTATGTGCTAAAGATCTTGGTGTACCAATCGTAATGCACGACTACCTTACTGGTGGTTTCACTGCTAACACTACATTAGCTTCTTATTGCCGTGACAATGGTCTTCTTCTTCACATCCACCGTGCAATGCACGCGGTTATTGACCGTCAACGTAACCACGGTATTCACTTCCGTGTTCTAGCTAAAACACTTCGTATGTCAGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTTACTTTAGGTTTCGTAGACTTAATGCGTGACGACTACGTAGAAAAAGACCGT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ Volvox_carteri_D6344 ---------------------------------------------------------------------GCTGGGTTCAAAGCCGGTGTAAAAGACTATCGTTTAACATACTACACACCTGACTACGTAGTAAAAGATACTGATATTTTAGCAGCATTCCGTATGACTCCACAACCAGGTGTTCCACCAGAAGAATGTGGTGCTGCTGTAGCTGCTGAATCTTCAACAGGTACTTGGACAACTGTATGGACTGACGGTTTAACAAGCCTTGATCGATACAAAGGTCGTTGTTATGACATCGAGCCTGTTCCAGGTGAAGACAACCAGTACATTGCTTATGTTGCTTACCCAATTGACTTATTCGAAGAAGGTTCAGTAACAAACATGTTTACTTCTATTGTAGGTAACGTATTCGGTTTCAAAGCTCTACGTGCTTTACGTCTTGAAGATCTTCGTATTCCACCTGCTTACGTTAAAACATTCCAAGGTCCACCACACGGTATTCAGGTTGAACGTGACAAACTAAACAAATATGGTCGTGGTCTTTTAGGTTGTACAATCAAACCTAAATTAGGTCTCTCAGCTAAAAACTACGGTCGTGCAGTTTACGAATGTTTACGTGGTGGTTTAGACTTTACTAAAGACGATGAAAACGTTAACTCACAACCATTCATGCGTTGGAGAGACCGTTTCCTTTTCGTAGCTGAAGCTATTTACAAAGCACAAGCAGAAACAGGTGAAGTAAAAGGTCATTATTTAAACGCTACAGCTGGTACATGCGAAGAAATGTTAAAACGTGCTCAATGTGCAAAAGAACTAGGTGTACCAATTATCATGCACGACTACTTAACTGGTGGTTTTACAGCTAACACATCATTAGCTTCTTACTGTCGTGATAATGGTCTTTTATTACACATTCACCGTGCTATGCACGCAGTAATTGACCGTCAACGTAACCATGGTATTCACTTCCGTGTTCTAGCAAAAGCTCTTCGTATGTCTGGTGGTGACCACCTTCACTCAGGTACTGTTGTAGGTAAACTAGAAGGTGAACGTGAAGTAACTTTAGGTTTCGTAGACTTAATGCGTGACGACTATATCGAAAAAGATCGTAGCCGTGGTATTTACTTTACACAAGACTGGTGTTCAATGCCAGGTGTAATGCCAGTTGCTTCAGGTGGTATTCACGTATGGCAC------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ ; end;